Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1004436..1004685 | Replicon | chromosome |
Accession | NZ_CP022901 | ||
Organism | Staphylococcus aureus strain 466 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | CGP97_RS04945 | Protein ID | WP_000623369.1 |
Coordinates | 1004436..1004543 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1004538..1004685 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CGP97_RS04920 | 1001109..1001678 | - | 570 | WP_000287265.1 | competence protein ComK | - |
CGP97_RS04925 | 1001888..1002106 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
CGP97_RS04930 | 1002187..1003173 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
CGP97_RS04935 | 1003372..1003548 | + | 177 | WP_000214898.1 | YkvS family protein | - |
CGP97_RS04940 | 1003563..1004165 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
CGP97_RS04945 | 1004436..1004543 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1004538..1004685 | - | 148 | - | - | Antitoxin |
CGP97_RS04950 | 1005082..1005183 | + | 102 | WP_001790623.1 | hypothetical protein | - |
CGP97_RS04955 | 1005193..1005465 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
CGP97_RS04960 | 1005509..1007473 | + | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
CGP97_RS04965 | 1007476..1007796 | + | 321 | WP_000873929.1 | YxeA family protein | - |
CGP97_RS04970 | 1007793..1008434 | + | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
CGP97_RS04975 | 1008522..1008812 | - | 291 | WP_001791476.1 | hypothetical protein | - |
CGP97_RS04980 | 1009153..1009428 | + | 276 | WP_115283836.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T79989 WP_000623369.1 NZ_CP022901:1004436-1004543 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T79989 NZ_CP022901:1004436-1004543 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT79989 NZ_CP022901:c1004685-1004538 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|