Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1004437..1004686 | Replicon | chromosome |
Accession | NZ_CP022899 | ||
Organism | Staphylococcus aureus strain 143 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | CGP95_RS04945 | Protein ID | WP_000623369.1 |
Coordinates | 1004437..1004544 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1004539..1004686 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CGP95_RS04920 | 1001110..1001679 | - | 570 | WP_000287265.1 | competence protein ComK | - |
CGP95_RS04925 | 1001889..1002107 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
CGP95_RS04930 | 1002188..1003174 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
CGP95_RS04935 | 1003373..1003549 | + | 177 | WP_000214898.1 | YkvS family protein | - |
CGP95_RS04940 | 1003564..1004166 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
CGP95_RS04945 | 1004437..1004544 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1004539..1004686 | - | 148 | - | - | Antitoxin |
CGP95_RS04950 | 1005083..1005184 | + | 102 | WP_001790623.1 | hypothetical protein | - |
CGP95_RS04955 | 1005194..1005466 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
CGP95_RS04960 | 1005510..1007474 | + | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
CGP95_RS04965 | 1007477..1007797 | + | 321 | WP_000873929.1 | YxeA family protein | - |
CGP95_RS04970 | 1007794..1008435 | + | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
CGP95_RS04975 | 1008523..1008813 | - | 291 | WP_001791476.1 | hypothetical protein | - |
CGP95_RS04980 | 1009154..1009429 | + | 276 | WP_115283836.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T79957 WP_000623369.1 NZ_CP022899:1004437-1004544 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T79957 NZ_CP022899:1004437-1004544 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT79957 NZ_CP022899:c1004686-1004539 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|