Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 974320..974569 | Replicon | chromosome |
Accession | NZ_CP021905 | ||
Organism | Staphylococcus aureus strain Seattle 1945 isolate G477 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | CD017_RS04785 | Protein ID | WP_000623369.1 |
Coordinates | 974320..974427 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 974422..974569 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CD017_RS04760 | 970993..971562 | - | 570 | WP_000287265.1 | competence protein ComK | - |
CD017_RS04765 | 971772..971990 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
CD017_RS04770 | 972071..973057 | - | 987 | WP_000668822.1 | lipoate--protein ligase | - |
CD017_RS04775 | 973256..973432 | + | 177 | WP_000214898.1 | YkvS family protein | - |
CD017_RS04780 | 973447..974049 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
CD017_RS04785 | 974320..974427 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 974422..974569 | - | 148 | - | - | Antitoxin |
CD017_RS04790 | 974966..975067 | + | 102 | WP_001790623.1 | hypothetical protein | - |
CD017_RS04795 | 975077..975349 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
CD017_RS04800 | 975393..977357 | + | 1965 | WP_000870820.1 | bacteriocin-associated integral membrane family protein | - |
CD017_RS04805 | 977360..977680 | + | 321 | WP_000873929.1 | YxeA family protein | - |
CD017_RS04810 | 977677..978318 | + | 642 | WP_000571183.1 | ABC transporter ATP-binding protein | - |
CD017_RS04815 | 978406..978696 | - | 291 | WP_001791476.1 | hypothetical protein | - |
CD017_RS04820 | 979037..979324 | + | 288 | WP_000410718.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | - | sspC / sspB / sspA | 971664..1008341 | 36677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T77833 WP_000623369.1 NZ_CP021905:974320-974427 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T77833 NZ_CP021905:974320-974427 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT77833 NZ_CP021905:c974569-974422 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|