Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 992229..992478 | Replicon | chromosome |
Accession | NZ_CP019594 | ||
Organism | Staphylococcus aureus strain GD1539 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | BZK08_RS05000 | Protein ID | WP_000623369.1 |
Coordinates | 992229..992336 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 992331..992478 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BZK08_RS04975 | 988903..989472 | - | 570 | WP_000287265.1 | competence protein ComK | - |
BZK08_RS04980 | 989682..989900 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
BZK08_RS04985 | 989981..990967 | - | 987 | WP_000668814.1 | lipoate--protein ligase | - |
BZK08_RS04990 | 991166..991342 | + | 177 | WP_000214898.1 | YkvS family protein | - |
BZK08_RS04995 | 991357..991959 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
BZK08_RS05000 | 992229..992336 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 992331..992478 | - | 148 | - | - | Antitoxin |
BZK08_RS05005 | 992971..993255 | + | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
BZK08_RS05010 | 993299..995263 | + | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
BZK08_RS05015 | 995266..995586 | + | 321 | WP_000668623.1 | YxeA family protein | - |
BZK08_RS05020 | 995583..996224 | + | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
BZK08_RS05025 | 996312..996602 | - | 291 | WP_001796515.1 | hypothetical protein | - |
BZK08_RS05030 | 996692..996880 | + | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
BZK08_RS05035 | 996969..997325 | - | 357 | WP_000766009.1 | DoxX family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T72781 WP_000623369.1 NZ_CP019594:992229-992336 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T72781 NZ_CP019594:992229-992336 [Staphylococcus aureus]
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT72781 NZ_CP019594:c992478-992331 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|