Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2628672..2628956 | Replicon | chromosome |
| Accession | NZ_CP015883 | ||
| Organism | Enterococcus faecalis strain sorialis | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | A6B47_RS13080 | Protein ID | WP_002386265.1 |
| Coordinates | 2628828..2628956 (-) | Length | 43 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2628672..2628879 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A6B47_RS13055 | 2624357..2625309 | - | 953 | Protein_2415 | siderophore ABC transporter substrate-binding protein | - |
| A6B47_RS13060 | 2625348..2626103 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| A6B47_RS13065 | 2626100..2627065 | - | 966 | WP_002387376.1 | iron chelate uptake ABC transporter family permease subunit | - |
| A6B47_RS13070 | 2627062..2628009 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| A6B47_RS13075 | 2628194..2628646 | + | 453 | WP_002378959.1 | YueI family protein | - |
| A6B47_RS13080 | 2628828..2628956 | - | 129 | WP_002386265.1 | hypothetical protein | Toxin |
| - | 2629138..2629325 | + | 188 | - | - | - |
| A6B47_RS13085 | 2629262..2629391 | - | 130 | Protein_2421 | putative holin-like toxin | - |
| A6B47_RS13090 | 2629554..2631824 | - | 2271 | WP_002378960.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| A6B47_RS13095 | 2631995..2632495 | + | 501 | WP_002378961.1 | cysteine hydrolase | - |
| A6B47_RS13100 | 2633056..2633952 | + | 897 | WP_087548684.1 | YitT family protein | - |
| A6B47_RS13055 | 2624357..2625309 | - | 953 | Protein_2415 | siderophore ABC transporter substrate-binding protein | - |
| A6B47_RS13060 | 2625348..2626103 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| A6B47_RS13065 | 2626100..2627065 | - | 966 | WP_002387376.1 | iron chelate uptake ABC transporter family permease subunit | - |
| A6B47_RS13070 | 2627062..2628009 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| A6B47_RS13075 | 2628194..2628646 | + | 453 | WP_002378959.1 | YueI family protein | - |
| A6B47_RS13080 | 2628828..2628956 | - | 129 | WP_002386265.1 | hypothetical protein | Toxin |
| A6B47_RS13085 | 2629262..2629391 | - | 130 | Protein_2421 | putative holin-like toxin | - |
| A6B47_RS13090 | 2629554..2631824 | - | 2271 | WP_002378960.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| A6B47_RS13095 | 2631995..2632495 | + | 501 | WP_002378961.1 | cysteine hydrolase | - |
| A6B47_RS13100 | 2633056..2633952 | + | 897 | WP_087548684.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 43 a.a. Molecular weight: 4742.66 Da Isoelectric Point: 7.0058
>T63859 WP_002386265.1 NZ_CP015883:c2628956-2628828 [Enterococcus faecalis]
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNNKK
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 129 bp
>T63859 NZ_CP015883:c2628956-2628828 [Enterococcus faecalis]
ATGCACTTTAACGAAAGGAGCATTTTTTTGTCAATCGAAGCGGCATTGGAATTGATGATTAGTTTTGCAGCGTTTGTTGC
ACTACTGATTTTCGGTATCCTTGAAGCAACGAAAAACAATAAAAAATAA
ATGCACTTTAACGAAAGGAGCATTTTTTTGTCAATCGAAGCGGCATTGGAATTGATGATTAGTTTTGCAGCGTTTGTTGC
ACTACTGATTTTCGGTATCCTTGAAGCAACGAAAAACAATAAAAAATAA
Antitoxin
Download Length: 208 bp
>AT63859 NZ_CP015883:2628672-2628879 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|