Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | ibs-sib/- |
| Location | 3195099..3195240 | Replicon | chromosome |
| Accession | NC_000913 | ||
| Organism | Escherichia coli str. K-12 substr. MG1655 | ||
| T1TAdb ID | TA07166 | ||
Toxin (Protein)
| Gene name | ibs | Uniprot ID | C1P617 |
| Locus tag | b4666 | Protein ID | YP_002791257.1 |
| Coordinates | 3195141..3195200 (+) | Length | 20 a.a. |
Antitoxin (RNA)
| Gene name | sib | ||
| Locus tag | b4611 | ||
| Coordinates | 3195098..3195247 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| b3048 | 3190632..3191696 | + | 1065 | NP_417520.1 | putative fimbrial protein YqiI | - |
| b3049 | 3191739..3191939 | - | 201 | NP_417521.1 | surface composition regulator | - |
| b3050 | 3192208..3192837 | + | 630 | NP_417522.1 | DUF1449 domain-containing inner membrane protein YqiJ | - |
| b3051 | 3192864..3194525 | + | 1662 | NP_417523.1 | flotillin family inner membrane protein YqiK | - |
| b4664 | 3194766..3194825 | + | 60 | YP_002791256.1 | putative toxic peptide IbsD | - |
| - | 3195098..3195247 | - | 150 | - | - | Antitoxin |
| b4666 | 3195141..3195200 | + | 60 | YP_002791257.1 | toxic peptide IbsE | Toxin |
| b3052 | 3195320..3196753 | - | 1434 | NP_417524.1 | fused heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase | - |
| b3053 | 3196801..3199641 | - | 2841 | NP_417525.1 | fused glutamine synthetase deadenylase/glutamine synthetase adenylyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 20 a.a. Molecular weight: 2206.90 Da Isoelectric Point: 8.7571
>T6357 YP_002791257.1 NC_000913:3195141-3195200 [Escherichia coli str. K-12 substr. MG1655]
MMKLVIILVVLLLLSFPTY
MMKLVIILVVLLLLSFPTY
Download Length: 60 bp
>T6357 NC_000913:3195141-3195200 [Escherichia coli str. K-12 substr. MG1655]
ATGATGAAGCTCGTCATCATACTGGTTGTGTTGTTACTGTTAAGTTTCCCGACTTACTAA
ATGATGAAGCTCGTCATCATACTGGTTGTGTTGTTACTGTTAAGTTTCCCGACTTACTAA
Antitoxin
Download Length: 150 bp
>AT6357 NC_000913:c3195247-3195098 [Escherichia coli str. K-12 substr. MG1655]
TAAAGGAACAAGGGTAAGGGAGGATTTCTCCCCCCTCTGATGAGTTGTTAGTAAGTCGGGAAACTTAACAGTAACAACAC
AACCAGTATGATGACGAGCTTCATCATAACCCTTTCCTTATACAAGGCCCCTTCTTCGGGAGGGGCTTTC
TAAAGGAACAAGGGTAAGGGAGGATTTCTCCCCCCTCTGATGAGTTGTTAGTAAGTCGGGAAACTTAACAGTAACAACAC
AACCAGTATGATGACGAGCTTCATCATAACCCTTTCCTTATACAAGGCCCCTTCTTCGGGAGGGGCTTTC
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Elizabeth M Fozo et al. (2008) Repression of small toxic protein synthesis by the Sib and OhsC small RNAs. Molecular Microbiology 70(5):1076-93. [PubMed:18710431]
(2) Elizabeth M Fozo et al. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Research 38(11):3743-59. [PubMed:20156992]