Detailed information of TA system
Experimentally validatedOverview
TA module
Type | I | Classification (family/domain) | ibs-sib/- |
Location | 3194723..3194865 | Replicon | chromosome |
Accession | NC_000913 | ||
Organism | Escherichia coli str. K-12 substr. MG1655 | ||
T1TAdb ID | TA07165 |
Toxin (Protein)
Gene name | ibs | Uniprot ID | C1P616 |
Locus tag | b4664 | Protein ID | YP_002791256.1 |
Coordinates | 3194766..3194825 (+) | Length | 20 a.a. |
Antitoxin (RNA)
Gene name | sib | ||
Locus tag | b4447 | ||
Coordinates | 3194723..3194872 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
b3047 | 3189881..3190630 | + | 750 | NP_417519.4 | putative fimbrial chaperone YqiH | - |
b3048 | 3190632..3191696 | + | 1065 | NP_417520.1 | putative fimbrial protein YqiI | - |
b3049 | 3191739..3191939 | - | 201 | NP_417521.1 | surface composition regulator | - |
b3050 | 3192208..3192837 | + | 630 | NP_417522.1 | DUF1449 domain-containing inner membrane protein YqiJ | - |
b3051 | 3192864..3194525 | + | 1662 | NP_417523.1 | flotillin family inner membrane protein YqiK | - |
- | 3194723..3194872 | - | 150 | - | - | Antitoxin |
b4664 | 3194766..3194825 | + | 60 | YP_002791256.1 | putative toxic peptide IbsD | Toxin |
b4666 | 3195141..3195200 | + | 60 | YP_002791257.1 | toxic peptide IbsE | - |
b3052 | 3195320..3196753 | - | 1434 | NP_417524.1 | fused heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase | - |
b3053 | 3196801..3199641 | - | 2841 | NP_417525.1 | fused glutamine synthetase deadenylase/glutamine synthetase adenylyltransferase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 20 a.a. Molecular weight: 2150.84 Da Isoelectric Point: 8.7571
>T6356 YP_002791256.1 NC_000913:3194766-3194825 [Escherichia coli str. K-12 substr. MG1655]
MMKLVIILIVLLLVSFAAY
MMKLVIILIVLLLVSFAAY
Download Length: 60 bp
>T6356 NC_000913:3194766-3194825 [Escherichia coli str. K-12 substr. MG1655]
ATGATGAAGCTCGTCATCATACTGATTGTGTTGTTACTCGTAAGTTTCGCAGCTTATTAA
ATGATGAAGCTCGTCATCATACTGATTGTGTTGTTACTCGTAAGTTTCGCAGCTTATTAA
Antitoxin
Download Length: 150 bp
>AT6356 NC_000913:c3194872-3194723 [Escherichia coli str. K-12 substr. MG1655]
TAAAGGAACAAGGGTGAGGGAGGATTTCTCCCCCCTCTGATTGGCTGTTAATAAGCTGCGAAACTTACGAGTAACAACAC
AATCAGTATGATGACGAGCTTCATCATAACCCTTTCCTTCTGTAAGGCCCCCTTCTTCGGGAGGGGCTTT
TAAAGGAACAAGGGTGAGGGAGGATTTCTCCCCCCTCTGATTGGCTGTTAATAAGCTGCGAAACTTACGAGTAACAACAC
AATCAGTATGATGACGAGCTTCATCATAACCCTTTCCTTCTGTAAGGCCCCCTTCTTCGGGAGGGGCTTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
References
(1) Elizabeth M Fozo et al. (2008) Repression of small toxic protein synthesis by the Sib and OhsC small RNAs. Molecular Microbiology 70(5):1076-93. [PubMed:18710431]
(2) Elizabeth M Fozo et al. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Research 38(11):3743-59. [PubMed:20156992]
experimental literature