Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 963197..963446 | Replicon | chromosome |
Accession | NZ_AP017922 | ||
Organism | Staphylococcus aureus strain JP02758 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | JP49775_RS04615 | Protein ID | WP_000623369.1 |
Coordinates | 963197..963304 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 963299..963446 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JP49775_RS04590 | 959871..960440 | - | 570 | WP_000287265.1 | competence protein ComK | - |
JP49775_RS04595 | 960650..960868 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
JP49775_RS04600 | 960949..961935 | - | 987 | WP_000668814.1 | lipoate--protein ligase | - |
JP49775_RS04605 | 962134..962310 | + | 177 | WP_000214898.1 | YkvS family protein | - |
JP49775_RS04610 | 962325..962927 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
JP49775_RS04615 | 963197..963304 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 963299..963446 | - | 148 | - | - | Antitoxin |
JP49775_RS04620 | 963939..964223 | + | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
JP49775_RS04625 | 964267..966231 | + | 1965 | WP_149036321.1 | bacteriocin-associated integral membrane family protein | - |
JP49775_RS04630 | 966234..966554 | + | 321 | WP_000668623.1 | YxeA family protein | - |
JP49775_RS04635 | 966551..967192 | + | 642 | WP_029549745.1 | ABC transporter ATP-binding protein | - |
JP49775_RS04640 | 967280..967570 | - | 291 | WP_001796515.1 | hypothetical protein | - |
JP49775_RS04645 | 967711..967848 | + | 138 | Protein_888 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
JP49775_RS04650 | 967937..968293 | - | 357 | WP_000766009.1 | DoxX family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T31423 WP_000623369.1 NZ_AP017922:963197-963304 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T31423 NZ_AP017922:963197-963304 [Staphylococcus aureus]
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 148 bp
>AT31423 NZ_AP017922:c963446-963299 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|