Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | yonT-SR6/- |
| Location | 2271736..2272220 | Replicon | chromosome |
| Accession | NZ_OX419573 | ||
| Organism | Bacillus subtilis isolate NRS6085 | ||
Toxin (Protein)
| Gene name | yonT | Uniprot ID | - |
| Locus tag | KJP57_RS11810 | Protein ID | WP_086343974.1 |
| Coordinates | 2271736..2271987 (-) | Length | 84 a.a. |
Antitoxin (RNA)
| Gene name | SR6 | ||
| Locus tag | - | ||
| Coordinates | 2272123..2272220 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KJP57_RS11770 (2267078) | 2267078..2267905 | - | 828 | WP_213408394.1 | YkgJ family cysteine cluster protein | - |
| KJP57_RS11775 (2268233) | 2268233..2268484 | - | 252 | WP_213408398.1 | hypothetical protein | - |
| KJP57_RS11780 (2268524) | 2268524..2268730 | - | 207 | WP_213408312.1 | hypothetical protein | - |
| KJP57_RS11785 (2268858) | 2268858..2269187 | - | 330 | WP_069322702.1 | hypothetical protein | - |
| KJP57_RS11790 (2269236) | 2269236..2269457 | - | 222 | WP_124058424.1 | hypothetical protein | - |
| KJP57_RS11795 (2269454) | 2269454..2269900 | - | 447 | WP_213408314.1 | hypothetical protein | - |
| KJP57_RS11800 (2270228) | 2270228..2271445 | - | 1218 | WP_192857821.1 | hypothetical protein | - |
| KJP57_RS11805 (2271533) | 2271533..2271691 | - | 159 | WP_069684683.1 | hypothetical protein | - |
| KJP57_RS11810 (2271736) | 2271736..2271987 | - | 252 | WP_086343974.1 | hypothetical protein | Toxin |
| KJP57_RS11815 (2272006) | 2272006..2272182 | - | 177 | WP_071579314.1 | hypothetical protein | - |
| - (2272123) | 2272123..2272220 | + | 98 | NuclAT_1 | - | Antitoxin |
| - (2272123) | 2272123..2272220 | + | 98 | NuclAT_1 | - | Antitoxin |
| - (2272123) | 2272123..2272220 | + | 98 | NuclAT_1 | - | Antitoxin |
| - (2272123) | 2272123..2272220 | + | 98 | NuclAT_1 | - | Antitoxin |
| KJP57_RS11820 (2273084) | 2273084..2273584 | - | 501 | WP_213408316.1 | hypothetical protein | - |
| KJP57_RS11825 (2273956) | 2273956..2274135 | + | 180 | WP_059293787.1 | hypothetical protein | - |
| KJP57_RS11830 (2274180) | 2274180..2276690 | + | 2511 | WP_213408318.1 | hypothetical protein | - |
| KJP57_RS11835 (2276935) | 2276935..2277213 | + | 279 | WP_213408320.1 | HU family DNA-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2199717..2336426 | 136709 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 84 a.a. Molecular weight: 10073.10 Da Isoelectric Point: 10.0301
>T296877 WP_086343974.1 NZ_OX419573:c2271987-2271736 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIVNMKRFSLWFTHITFIGLFLMFQLIKDYFSSEAQTLINTIFVVTCIIAILLWIIYFVFLKLRN
KSH
MNFSFSSYPYYNMIKHIVNMKRFSLWFTHITFIGLFLMFQLIKDYFSSEAQTLINTIFVVTCIIAILLWIIYFVFLKLRN
KSH
Download Length: 252 bp
Antitoxin
Download Length: 98 bp
>AT296877 NZ_OX419573:2272123-2272220 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTATGATACCCACTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATA
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTATGATACCCACTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
