Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | yonT-as-bsrH/- |
| Location | 2204922..2205409 | Replicon | chromosome |
| Accession | NZ_OX419564 | ||
| Organism | Bacillus subtilis isolate NRS6127 | ||
Toxin (Protein)
| Gene name | yonT | Uniprot ID | - |
| Locus tag | KJP48_RS11410 | Protein ID | WP_134853524.1 |
| Coordinates | 2204922..2205173 (-) | Length | 84 a.a. |
Antitoxin (RNA)
| Gene name | as-bsrH | ||
| Locus tag | - | ||
| Coordinates | 2205309..2205409 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KJP48_RS11370 (2200705) | 2200705..2201259 | - | 555 | WP_213386207.1 | hypothetical protein | - |
| KJP48_RS11375 (2201568) | 2201568..2201933 | - | 366 | WP_213386206.1 | hypothetical protein | - |
| KJP48_RS11380 (2201967) | 2201967..2202236 | - | 270 | WP_006640590.1 | hypothetical protein | - |
| KJP48_RS11385 (2202268) | 2202268..2202471 | - | 204 | WP_213386204.1 | hypothetical protein | - |
| KJP48_RS11390 (2202535) | 2202535..2202738 | - | 204 | WP_213386203.1 | hypothetical protein | - |
| KJP48_RS11395 (2202831) | 2202831..2203076 | - | 246 | WP_144500927.1 | hypothetical protein | - |
| KJP48_RS11400 (2203390) | 2203390..2204607 | - | 1218 | WP_144500928.1 | hypothetical protein | - |
| KJP48_RS11405 (2204689) | 2204689..2204877 | - | 189 | WP_003230987.1 | hypothetical protein | - |
| KJP48_RS11410 (2204922) | 2204922..2205173 | - | 252 | WP_134853524.1 | hypothetical protein | Toxin |
| KJP48_RS11415 (2205192) | 2205192..2205368 | - | 177 | WP_032721653.1 | hypothetical protein | - |
| - (2205309) | 2205309..2205409 | + | 101 | NuclAT_0 | - | Antitoxin |
| - (2205309) | 2205309..2205409 | + | 101 | NuclAT_0 | - | Antitoxin |
| - (2205309) | 2205309..2205409 | + | 101 | NuclAT_0 | - | Antitoxin |
| - (2205309) | 2205309..2205409 | + | 101 | NuclAT_0 | - | Antitoxin |
| KJP48_RS11420 (2206317) | 2206317..2206511 | + | 195 | WP_072692657.1 | hypothetical protein | - |
| KJP48_RS11425 (2206551) | 2206551..2209058 | + | 2508 | WP_213393208.1 | hypothetical protein | - |
| KJP48_RS11430 (2209322) | 2209322..2209597 | + | 276 | WP_144500930.1 | HU family DNA-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2132614..2265676 | 133062 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 84 a.a. Molecular weight: 10029.09 Da Isoelectric Point: 10.2041
>T296821 WP_134853524.1 NZ_OX419564:c2205173-2204922 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIVNMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGKALINTIFVVTCIIAILLWIIYFVFLKLRN
KSH
MNFSFSSYPYYNMIKHIVNMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGKALINTIFVVTCIIAILLWIIYFVFLKLRN
KSH
Download Length: 252 bp
Antitoxin
Download Length: 101 bp
>AT296821 NZ_OX419564:2205309-2205409 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCACTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCACTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
