Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2548715..2548975 | Replicon | chromosome |
| Accession | NZ_OD940434 | ||
| Organism | Enterococcus faecalis isolate BX5936 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | KJA96_RS12315 | Protein ID | WP_075551663.1 |
| Coordinates | 2548874..2548975 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2548715..2548925 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KJA96_RS12290 | 2544399..2545352 | - | 954 | WP_010709946.1 | siderophore ABC transporter substrate-binding protein | - |
| KJA96_RS12295 | 2545391..2546146 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| KJA96_RS12300 | 2546143..2547108 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| KJA96_RS12305 | 2547105..2548052 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
| KJA96_RS12310 | 2548237..2548689 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - | 2548715..2548925 | + | 211 | - | - | Antitoxin |
| KJA96_RS12315 | 2548874..2548975 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| KJA96_RS12320 | 2549164..2551434 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| KJA96_RS12325 | 2551605..2552105 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
| KJA96_RS12330 | 2552804..2553700 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T294560 WP_075551663.1 NZ_OD940434:c2548975-2548874 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT294560 NZ_OD940434:2548715-2548925 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|