Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-RNAII/- |
Location | 2533936..2534196 | Replicon | chromosome |
Accession | NZ_OD940431 | ||
Organism | Enterococcus faecalis isolate TM6294 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | KJA93_RS12125 | Protein ID | WP_021164442.1 |
Coordinates | 2534095..2534196 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | RNAII | ||
Locus tag | - | ||
Coordinates | 2533936..2534141 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KJA93_RS12100 | 2529590..2530543 | - | 954 | WP_126254760.1 | siderophore ABC transporter substrate-binding protein | - |
KJA93_RS12105 | 2530582..2531337 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
KJA93_RS12110 | 2531334..2532299 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
KJA93_RS12115 | 2532296..2533243 | - | 948 | WP_002394759.1 | iron chelate uptake ABC transporter family permease subunit | - |
KJA93_RS12120 | 2533428..2533880 | + | 453 | WP_126254759.1 | YueI family protein | - |
- | 2533936..2534141 | + | 206 | - | - | Antitoxin |
KJA93_RS12125 | 2534095..2534196 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
KJA93_RS12130 | 2534387..2536657 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
KJA93_RS12135 | 2536828..2537334 | + | 507 | WP_126254758.1 | cysteine hydrolase family protein | - |
KJA93_RS12140 | 2537524..2538420 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T294535 WP_021164442.1 NZ_OD940431:c2534196-2534095 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 206 bp
>AT294535 NZ_OD940431:2533936-2534141 [Enterococcus faecalis]
TTCCATTTATAATAGAATTGTGCTATTATAAAGATGAAAAAGAGAGGTATACGGGTACATACCTCTCCTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTATAATAGAATTGTGCTATTATAAAGATGAAAAAGAGAGGTATACGGGTACATACCTCTCCTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|