Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 1026818..1027078 | Replicon | chromosome |
| Accession | NZ_OD940422 | ||
| Organism | Enterococcus faecalis isolate WE0851 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | KJA80_RS04820 | Protein ID | WP_228759711.1 |
| Coordinates | 1026977..1027078 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 1026818..1027023 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KJA80_RS04795 | 1022472..1023425 | - | 954 | WP_002415458.1 | siderophore ABC transporter substrate-binding protein | - |
| KJA80_RS04800 | 1023464..1024219 | - | 756 | WP_002415456.1 | ATP-binding cassette domain-containing protein | - |
| KJA80_RS04805 | 1024216..1025181 | - | 966 | WP_002415455.1 | iron chelate uptake ABC transporter family permease subunit | - |
| KJA80_RS04810 | 1025178..1026125 | - | 948 | WP_002375573.1 | iron chelate uptake ABC transporter family permease subunit | - |
| KJA80_RS04815 | 1026310..1026762 | + | 453 | WP_002367417.1 | YueI family protein | - |
| - | 1026818..1027023 | + | 206 | - | - | Antitoxin |
| KJA80_RS04820 | 1026977..1027078 | - | 102 | WP_228759711.1 | putative holin-like toxin | Toxin |
| KJA80_RS04825 | 1027269..1029539 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| KJA80_RS04830 | 1029710..1030210 | + | 501 | WP_002415453.1 | cysteine hydrolase family protein | - |
| KJA80_RS04835 | 1031009..1031905 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3683.42 Da Isoelectric Point: 4.2645
>T294515 WP_228759711.1 NZ_OD940422:c1027078-1026977 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFDILEATKNDKK
MSIEATLELMISFATLVALLIFDILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 206 bp
>AT294515 NZ_OD940422:1026818-1027023 [Enterococcus faecalis]
TTCCATTTATAATAGAATTGTGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATATCGAAAATCAGTA
TTCCATTTATAATAGAATTGTGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAACG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATATCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|