Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2734594..2734854 | Replicon | chromosome |
| Accession | NZ_OD940420 | ||
| Organism | Enterococcus faecalis isolate WE0438 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | KJA91_RS13110 | Protein ID | WP_075551663.1 |
| Coordinates | 2734753..2734854 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2734594..2734804 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KJA91_RS13085 (2730278) | 2730278..2731231 | - | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
| KJA91_RS13090 (2731270) | 2731270..2732025 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| KJA91_RS13095 (2732022) | 2732022..2732987 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| KJA91_RS13100 (2732984) | 2732984..2733931 | - | 948 | WP_213044527.1 | iron chelate uptake ABC transporter family permease subunit | - |
| KJA91_RS13105 (2734116) | 2734116..2734568 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (2734594) | 2734594..2734804 | + | 211 | NuclAT_9 | - | Antitoxin |
| - (2734631) | 2734631..2734808 | + | 178 | NuclAT_8 | - | - |
| KJA91_RS13110 (2734753) | 2734753..2734854 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| - (2735028) | 2735028..2735237 | + | 210 | NuclAT_10 | - | - |
| - (2735062) | 2735062..2735241 | + | 180 | NuclAT_7 | - | - |
| KJA91_RS13115 (2735186) | 2735186..2735287 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| KJA91_RS13120 (2735477) | 2735477..2737747 | - | 2271 | WP_002398160.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| KJA91_RS13125 (2737918) | 2737918..2738418 | + | 501 | WP_002365352.1 | cysteine hydrolase family protein | - |
| KJA91_RS13130 (2738721) | 2738721..2739617 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T294498 WP_075551663.1 NZ_OD940420:c2734854-2734753 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT294498 NZ_OD940420:2734594-2734804 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|