Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 1999506..1999703 | Replicon | chromosome |
| Accession | NZ_LT992476 | ||
| Organism | Staphylococcus aureus isolate 21_LA_436 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | DXE57_RS10270 | Protein ID | WP_000623369.1 |
| Coordinates | 1999596..1999703 (-) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF3 | ||
| Locus tag | - | ||
| Coordinates | 1999506..1999543 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXE57_RS10235 | 1994607..1994963 | + | 357 | WP_000766009.1 | DoxX family protein | - |
| DXE57_RS10240 | 1995052..1995240 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
| DXE57_RS10245 | 1995330..1995620 | + | 291 | WP_001796515.1 | hypothetical protein | - |
| DXE57_RS10250 | 1995708..1996349 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
| DXE57_RS10255 | 1996346..1996666 | - | 321 | WP_000668623.1 | YxeA family protein | - |
| DXE57_RS10260 | 1996669..1998633 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
| DXE57_RS10265 | 1998677..1998961 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
| - | 1999506..1999543 | + | 38 | - | - | Antitoxin |
| DXE57_RS10270 | 1999596..1999703 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
| DXE57_RS10275 | 1999973..2000575 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
| DXE57_RS10280 | 2000590..2000766 | - | 177 | WP_000214898.1 | YkvS family protein | - |
| DXE57_RS10285 | 2000965..2001951 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
| DXE57_RS10290 | 2002032..2002250 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
| DXE57_RS10295 | 2002460..2003029 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294323 WP_000623369.1 NZ_LT992476:c1999703-1999596 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT294323 NZ_LT992476:1999506-1999543 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|