Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1361676..1361873 | Replicon | chromosome |
Accession | NZ_LT992475 | ||
Organism | Staphylococcus aureus isolate 20_LA_415 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DXE41_RS07195 | Protein ID | WP_000623369.1 |
Coordinates | 1361766..1361873 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 1361676..1361713 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DXE41_RS07160 | 1356777..1357133 | + | 357 | WP_000766009.1 | DoxX family protein | - |
DXE41_RS07165 | 1357222..1357410 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
DXE41_RS07170 | 1357500..1357790 | + | 291 | WP_001796515.1 | hypothetical protein | - |
DXE41_RS07175 | 1357878..1358519 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
DXE41_RS07180 | 1358516..1358836 | - | 321 | WP_000668623.1 | YxeA family protein | - |
DXE41_RS07185 | 1358839..1360803 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
DXE41_RS07190 | 1360847..1361131 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
- | 1361676..1361713 | + | 38 | - | - | Antitoxin |
DXE41_RS07195 | 1361766..1361873 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
DXE41_RS07200 | 1362143..1362745 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DXE41_RS07205 | 1362760..1362936 | - | 177 | WP_000214898.1 | YkvS family protein | - |
DXE41_RS07210 | 1363135..1364121 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
DXE41_RS07215 | 1364202..1364420 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DXE41_RS07220 | 1364630..1365199 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294304 WP_000623369.1 NZ_LT992475:c1361873-1361766 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT294304 NZ_LT992475:1361676-1361713 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|