Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 2823533..2823750 | Replicon | chromosome |
| Accession | NZ_LT992474 | ||
| Organism | Staphylococcus aureus isolate 19_LA_388 | ||
Toxin (Protein)
| Gene name | SprG3 | Uniprot ID | - |
| Locus tag | DXE66_RS14570 | Protein ID | WP_114639807.1 |
| Coordinates | 2823646..2823750 (-) | Length | 35 a.a. |
Antitoxin (RNA)
| Gene name | SprF2 | ||
| Locus tag | - | ||
| Coordinates | 2823533..2823588 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXE66_RS14550 | 2819672..2820337 | - | 666 | WP_001024099.1 | SDR family oxidoreductase | - |
| DXE66_RS14555 | 2820489..2820809 | + | 321 | WP_000003759.1 | Zn(II)-responsive metalloregulatory transcriptional repressor CzrA | - |
| DXE66_RS14560 | 2820811..2821791 | + | 981 | WP_000019735.1 | CDF family zinc efflux transporter CzrB | - |
| DXE66_RS14565 | 2822057..2823148 | + | 1092 | WP_000495673.1 | hypothetical protein | - |
| - | 2823533..2823588 | + | 56 | - | - | Antitoxin |
| DXE66_RS14570 | 2823646..2823750 | - | 105 | WP_114639807.1 | hypothetical protein | Toxin |
| DXE66_RS14585 | 2824430..2824588 | + | 159 | WP_001792784.1 | hypothetical protein | - |
| DXE66_RS14590 | 2825024..2825116 | + | 93 | WP_000220902.1 | hypothetical protein | - |
| DXE66_RS14595 | 2825246..2826103 | - | 858 | WP_000370942.1 | Cof-type HAD-IIB family hydrolase | - |
| DXE66_RS14600 | 2826171..2826953 | - | 783 | WP_000908191.1 | ABC transporter ATP-binding protein | - |
| DXE66_RS14605 | 2827243..2827851 | - | 609 | WP_000101714.1 | TIR domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 35 a.a. Molecular weight: 3872.75 Da Isoelectric Point: 5.5724
>T294294 WP_114639807.1 NZ_LT992474:c2823750-2823646 [Staphylococcus aureus]
MLLLERTSMSDLEMLMVVLTIIGLVLISTQDHKK
MLLLERTSMSDLEMLMVVLTIIGLVLISTQDHKK
Download Length: 105 bp
Antitoxin
Download Length: 56 bp
>AT294294 NZ_LT992474:2823533-2823588 [Staphylococcus aureus]
AAAAAGGGCAACACTCGGAAACATGTTACCCTAATGAGCCCGTTAAAAAGACGGTG
AAAAAGGGCAACACTCGGAAACATGTTACCCTAATGAGCCCGTTAAAAAGACGGTG
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|