Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 1655038..1655287 | Replicon | chromosome |
| Accession | NZ_LT992474 | ||
| Organism | Staphylococcus aureus isolate 19_LA_388 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | DXE66_RS08445 | Protein ID | WP_000623369.1 |
| Coordinates | 1655038..1655145 (+) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF2 | ||
| Locus tag | - | ||
| Coordinates | 1655140..1655287 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXE66_RS08420 | 1651712..1652281 | - | 570 | WP_000287265.1 | competence protein ComK | - |
| DXE66_RS08425 | 1652491..1652709 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
| DXE66_RS08430 | 1652790..1653776 | - | 987 | WP_000668814.1 | lipoate--protein ligase | - |
| DXE66_RS08435 | 1653975..1654151 | + | 177 | WP_000214898.1 | YkvS family protein | - |
| DXE66_RS08440 | 1654166..1654768 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
| DXE66_RS08445 | 1655038..1655145 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
| - | 1655140..1655287 | - | 148 | - | - | Antitoxin |
| DXE66_RS08450 | 1655780..1656064 | + | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
| DXE66_RS08455 | 1656108..1658072 | + | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
| DXE66_RS08460 | 1658075..1658395 | + | 321 | WP_000668623.1 | YxeA family protein | - |
| DXE66_RS08465 | 1658392..1659033 | + | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
| DXE66_RS08470 | 1659121..1659411 | - | 291 | WP_001796515.1 | hypothetical protein | - |
| DXE66_RS08475 | 1659501..1659689 | + | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
| DXE66_RS08480 | 1659778..1660134 | - | 357 | WP_000766009.1 | DoxX family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294285 WP_000623369.1 NZ_LT992474:1655038-1655145 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 148 bp
>AT294285 NZ_LT992474:c1655287-1655140 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|