Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 848106..848303 | Replicon | chromosome |
Accession | NZ_LT992473 | ||
Organism | Staphylococcus aureus isolate 14_5418 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DXE48_RS04150 | Protein ID | WP_000623369.1 |
Coordinates | 848196..848303 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 848106..848143 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DXE48_RS04115 | 843207..843563 | + | 357 | WP_000766009.1 | DoxX family protein | - |
DXE48_RS04120 | 843652..843840 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
DXE48_RS04125 | 843930..844220 | + | 291 | WP_001796515.1 | hypothetical protein | - |
DXE48_RS04130 | 844308..844949 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
DXE48_RS04135 | 844946..845266 | - | 321 | WP_000668623.1 | YxeA family protein | - |
DXE48_RS04140 | 845269..847233 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
DXE48_RS04145 | 847277..847561 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
- | 848106..848143 | + | 38 | - | - | Antitoxin |
DXE48_RS04150 | 848196..848303 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
DXE48_RS04155 | 848573..849175 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DXE48_RS04160 | 849190..849366 | - | 177 | WP_000214898.1 | YkvS family protein | - |
DXE48_RS04165 | 849565..850551 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
DXE48_RS04170 | 850632..850850 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DXE48_RS04175 | 851060..851629 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294264 WP_000623369.1 NZ_LT992473:c848303-848196 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT294264 NZ_LT992473:848106-848143 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|