Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 2007408..2007657 | Replicon | chromosome |
Accession | NZ_LT992472 | ||
Organism | Staphylococcus aureus isolate 10_5235 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DXE26_RS10460 | Protein ID | WP_000623369.1 |
Coordinates | 2007408..2007515 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 2007510..2007657 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DXE26_RS10435 | 2004082..2004651 | - | 570 | WP_000287260.1 | competence protein ComK | - |
DXE26_RS10440 | 2004861..2005079 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DXE26_RS10445 | 2005160..2006146 | - | 987 | WP_000668814.1 | lipoate--protein ligase | - |
DXE26_RS10450 | 2006345..2006521 | + | 177 | WP_000214898.1 | YkvS family protein | - |
DXE26_RS10455 | 2006536..2007138 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DXE26_RS10460 | 2007408..2007515 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 2007510..2007657 | - | 148 | - | - | Antitoxin |
DXE26_RS10465 | 2008150..2008434 | + | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
DXE26_RS10470 | 2008478..2010442 | + | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
DXE26_RS10475 | 2010445..2010765 | + | 321 | WP_000668623.1 | YxeA family protein | - |
DXE26_RS10480 | 2010762..2011403 | + | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
DXE26_RS10485 | 2011491..2011781 | - | 291 | WP_001796515.1 | hypothetical protein | - |
DXE26_RS10490 | 2011871..2012059 | + | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
DXE26_RS10495 | 2012148..2012504 | - | 357 | WP_000766009.1 | DoxX family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294263 WP_000623369.1 NZ_LT992472:2007408-2007515 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 148 bp
>AT294263 NZ_LT992472:c2007657-2007510 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGTAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTGCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|