Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 2038650..2038847 | Replicon | chromosome |
Accession | NZ_LT992466 | ||
Organism | Staphylococcus aureus isolate 4_LA_208 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DXE30_RS10375 | Protein ID | WP_000623369.1 |
Coordinates | 2038740..2038847 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 2038650..2038687 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DXE30_RS10340 | 2033751..2034107 | + | 357 | WP_000766009.1 | DoxX family protein | - |
DXE30_RS10345 | 2034196..2034384 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
DXE30_RS10350 | 2034474..2034764 | + | 291 | WP_001796515.1 | hypothetical protein | - |
DXE30_RS10355 | 2034852..2035493 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
DXE30_RS10360 | 2035490..2035810 | - | 321 | WP_000668623.1 | YxeA family protein | - |
DXE30_RS10365 | 2035813..2037777 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
DXE30_RS10370 | 2037821..2038105 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
- | 2038650..2038687 | + | 38 | - | - | Antitoxin |
DXE30_RS10375 | 2038740..2038847 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
DXE30_RS10380 | 2039117..2039719 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DXE30_RS10385 | 2039734..2039910 | - | 177 | WP_000214898.1 | YkvS family protein | - |
DXE30_RS10390 | 2040109..2041095 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
DXE30_RS10395 | 2041176..2041394 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DXE30_RS10400 | 2041604..2042173 | + | 570 | WP_000287260.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294174 WP_000623369.1 NZ_LT992466:c2038847-2038740 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT294174 NZ_LT992466:2038650-2038687 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|