Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 1577472..1577669 | Replicon | chromosome |
| Accession | NZ_LT992464 | ||
| Organism | Staphylococcus aureus isolate 3_LA_115 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | DXE56_RS08305 | Protein ID | WP_000623369.1 |
| Coordinates | 1577562..1577669 (-) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF3 | ||
| Locus tag | - | ||
| Coordinates | 1577472..1577509 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXE56_RS08270 | 1572573..1572929 | + | 357 | WP_000766009.1 | DoxX family protein | - |
| DXE56_RS08275 | 1573018..1573206 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
| DXE56_RS08280 | 1573296..1573586 | + | 291 | WP_001796515.1 | hypothetical protein | - |
| DXE56_RS08285 | 1573674..1574315 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
| DXE56_RS08290 | 1574312..1574632 | - | 321 | WP_000668623.1 | YxeA family protein | - |
| DXE56_RS08295 | 1574635..1576599 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
| DXE56_RS08300 | 1576643..1576927 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
| - | 1577472..1577509 | + | 38 | - | - | Antitoxin |
| DXE56_RS08305 | 1577562..1577669 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
| DXE56_RS08310 | 1577939..1578541 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
| DXE56_RS08315 | 1578556..1578732 | - | 177 | WP_000214898.1 | YkvS family protein | - |
| DXE56_RS08320 | 1578931..1579917 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
| DXE56_RS08325 | 1579998..1580216 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
| DXE56_RS08330 | 1580426..1580995 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294140 WP_000623369.1 NZ_LT992464:c1577669-1577562 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT294140 NZ_LT992464:1577472-1577509 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|