Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 2738202..2738399 | Replicon | chromosome |
Accession | NZ_LT992460 | ||
Organism | Staphylococcus aureus isolate 9_LA_281 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DXE39_RS14220 | Protein ID | WP_000623369.1 |
Coordinates | 2738292..2738399 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 2738202..2738239 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DXE39_RS14185 | 2733303..2733659 | + | 357 | WP_000766009.1 | DoxX family protein | - |
DXE39_RS14190 | 2733748..2733936 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
DXE39_RS14195 | 2734026..2734316 | + | 291 | WP_001796515.1 | hypothetical protein | - |
DXE39_RS14200 | 2734404..2735045 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
DXE39_RS14205 | 2735042..2735362 | - | 321 | WP_000668623.1 | YxeA family protein | - |
DXE39_RS14210 | 2735365..2737329 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
DXE39_RS14215 | 2737373..2737657 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
- | 2738202..2738239 | + | 38 | - | - | Antitoxin |
DXE39_RS14220 | 2738292..2738399 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
DXE39_RS14225 | 2738669..2739271 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DXE39_RS14230 | 2739286..2739463 | - | 178 | Protein_2638 | YkvS family protein | - |
DXE39_RS14235 | 2739662..2740648 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
DXE39_RS14240 | 2740729..2740947 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DXE39_RS14245 | 2741157..2741726 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294080 WP_000623369.1 NZ_LT992460:c2738399-2738292 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T294080 NZ_LT992460:c2738399-2738292 [Staphylococcus aureus]
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAATGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 38 bp
>AT294080 NZ_LT992460:2738202-2738239 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|