Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 291886..292083 | Replicon | chromosome |
Accession | NZ_LT992456 | ||
Organism | Staphylococcus aureus isolate 1_1439 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DXE58_RS01485 | Protein ID | WP_000623369.1 |
Coordinates | 291976..292083 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 291886..291923 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DXE58_RS01450 | 286987..287343 | + | 357 | WP_000766009.1 | DoxX family protein | - |
DXE58_RS01455 | 287432..287620 | - | 189 | WP_157958947.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
DXE58_RS01460 | 287710..288000 | + | 291 | WP_001796515.1 | hypothetical protein | - |
DXE58_RS01465 | 288088..288729 | - | 642 | WP_000571192.1 | ABC transporter ATP-binding protein | - |
DXE58_RS01470 | 288726..289046 | - | 321 | WP_000668623.1 | YxeA family protein | - |
DXE58_RS01475 | 289049..291013 | - | 1965 | WP_000870811.1 | bacteriocin-associated integral membrane family protein | - |
DXE58_RS01480 | 291057..291341 | - | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
- | 291886..291923 | + | 38 | - | - | Antitoxin |
DXE58_RS01485 | 291976..292083 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
DXE58_RS01490 | 292353..292955 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DXE58_RS01495 | 292970..293146 | - | 177 | WP_000214898.1 | YkvS family protein | - |
DXE58_RS01500 | 293345..294331 | + | 987 | WP_000668814.1 | lipoate--protein ligase | - |
DXE58_RS01505 | 294412..294630 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DXE58_RS01510 | 294840..295409 | + | 570 | WP_000287260.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T294032 WP_000623369.1 NZ_LT992456:c292083-291976 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT294032 NZ_LT992456:291886-291923 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|