Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1046279..1046528 | Replicon | chromosome |
Accession | NZ_LS483484 | ||
Organism | Staphylococcus aureus strain NCTC13277 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DQL77_RS05190 | Protein ID | WP_000623369.1 |
Coordinates | 1046279..1046386 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1046381..1046528 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DQL77_RS05165 | 1042952..1043521 | - | 570 | WP_000287265.1 | competence protein ComK | - |
DQL77_RS05170 | 1043731..1043949 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
DQL77_RS05175 | 1044030..1045016 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
DQL77_RS05180 | 1045215..1045391 | + | 177 | WP_000214898.1 | YkvS family protein | - |
DQL77_RS05185 | 1045406..1046008 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DQL77_RS05190 | 1046279..1046386 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1046381..1046528 | - | 148 | - | - | Antitoxin |
DQL77_RS05195 | 1046925..1047026 | + | 102 | WP_001790623.1 | hypothetical protein | - |
DQL77_RS05200 | 1047036..1047308 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
DQL77_RS05205 | 1047352..1049316 | + | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
DQL77_RS05210 | 1049319..1049639 | + | 321 | WP_000873929.1 | YxeA family protein | - |
DQL77_RS05215 | 1049636..1050277 | + | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
DQL77_RS05220 | 1050365..1050655 | - | 291 | WP_001791476.1 | hypothetical protein | - |
DQL77_RS05225 | 1050996..1051283 | + | 288 | WP_000410718.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T292625 WP_000623369.1 NZ_LS483484:1046279-1046386 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 148 bp
>AT292625 NZ_LS483484:c1046528-1046381 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|