Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | SprG2-SprA2AS/- |
Location | 976837..977054 | Replicon | chromosome |
Accession | NZ_LS483300 | ||
Organism | Staphylococcus aureus strain NCTC7485 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | DQL62_RS04970 | Protein ID | WP_000623369.1 |
Coordinates | 976837..976944 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprA2AS | ||
Locus tag | - | ||
Coordinates | 976939..977054 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DQL62_RS04945 | 973510..974079 | - | 570 | WP_000283455.1 | competence protein ComK | - |
DQL62_RS04950 | 974289..974507 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
DQL62_RS04955 | 974588..975574 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
DQL62_RS04960 | 975773..975949 | + | 177 | WP_000214898.1 | YkvS family protein | - |
DQL62_RS04965 | 975964..976566 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
DQL62_RS04970 | 976837..976944 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 976939..977054 | - | 116 | - | - | Antitoxin |
DQL62_RS04975 | 977483..977584 | + | 102 | WP_042852647.1 | hypothetical protein | - |
DQL62_RS04980 | 977594..977866 | + | 273 | WP_078062708.1 | lactococcin 972 family bacteriocin | - |
DQL62_RS04985 | 977909..979873 | + | 1965 | WP_000870792.1 | bacteriocin-associated integral membrane family protein | - |
DQL62_RS04990 | 979876..980199 | + | 324 | WP_000668625.1 | YxeA family protein | - |
DQL62_RS04995 | 980196..980834 | + | 639 | WP_042852651.1 | ABC transporter ATP-binding protein | - |
DQL62_RS05000 | 980922..981212 | - | 291 | WP_001795266.1 | hypothetical protein | - |
DQL62_RS05005 | 981545..981832 | + | 288 | WP_000410749.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T292190 WP_000623369.1 NZ_LS483300:976837-976944 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 116 bp
>AT292190 NZ_LS483300:c977054-976939 [Staphylococcus aureus]
GTAAAAAGACGACATGCAGGAACATGTCGCCAAATGAGCCCGTTAAAAAGACGGTGACTAAATGAGATTTTCTTTAACCA
TCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
GTAAAAAGACGACATGCAGGAACATGTCGCCAAATGAGCCCGTTAAAAAGACGGTGACTAAATGAGATTTTCTTTAACCA
TCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|