Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2566305..2566591 | Replicon | chromosome |
| Accession | NZ_LR698844 | ||
| Organism | Enterococcus faecalis isolate MGYG-HGUT-01694 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | FXY61_RS12620 | Protein ID | WP_002393909.1 |
| Coordinates | 2566463..2566591 (-) | Length | 43 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2566305..2566514 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FXY61_RS12590 | 2561558..2562511 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
| FXY61_RS12595 | 2562550..2563305 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| FXY61_RS12600 | 2563302..2564267 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| FXY61_RS12605 | 2564264..2565211 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| FXY61_RS12610 | 2565396..2565848 | + | 453 | WP_002389410.1 | YueI family protein | - |
| FXY61_RS12615 | 2566030..2566157 | - | 128 | Protein_2454 | putative holin-like toxin | - |
| - | 2566305..2566514 | + | 210 | - | - | Antitoxin |
| FXY61_RS12620 | 2566463..2566591 | - | 129 | WP_002393909.1 | hypothetical protein | Toxin |
| FXY61_RS12625 | 2566754..2569024 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| FXY61_RS12630 | 2569195..2569695 | + | 501 | WP_002372831.1 | cysteine hydrolase | - |
| FXY61_RS12635 | 2570094..2570990 | + | 897 | WP_002389477.1 | YitT family protein | - |
| FXY61_RS12640 | 2571041..2571439 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 43 a.a. Molecular weight: 4743.64 Da Isoelectric Point: 5.6470
>T288666 WP_002393909.1 NZ_LR698844:c2566591-2566463 [Enterococcus faecalis]
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNDKK
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 129 bp
Antitoxin
Download Length: 210 bp
>AT288666 NZ_LR698844:2566305-2566514 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|