Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2476346..2476598 | Replicon | chromosome |
| Accession | NZ_LR134312 | ||
| Organism | Enterococcus faecalis strain NCTC8745 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | EL135_RS12365 | Protein ID | WP_002393909.1 |
| Coordinates | 2476470..2476598 (-) | Length | 43 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2476346..2476525 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| EL135_RS12335 | 2471562..2472515 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
| EL135_RS12340 | 2472554..2473309 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| EL135_RS12345 | 2473306..2474271 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| EL135_RS12350 | 2474268..2475215 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| EL135_RS12355 | 2475400..2475852 | + | 453 | WP_002354958.1 | YueI family protein | - |
| EL135_RS12360 | 2476037..2476164 | - | 128 | Protein_2283 | putative holin-like toxin | - |
| - | 2476346..2476525 | + | 180 | - | - | Antitoxin |
| EL135_RS12365 | 2476470..2476598 | - | 129 | WP_002393909.1 | hypothetical protein | Toxin |
| EL135_RS12370 | 2476761..2479031 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| EL135_RS12375 | 2479202..2479702 | + | 501 | WP_002354954.1 | cysteine hydrolase | - |
| EL135_RS12380 | 2480249..2481145 | + | 897 | WP_002354953.1 | YitT family protein | - |
| EL135_RS12385 | 2481196..2481594 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 43 a.a. Molecular weight: 4743.64 Da Isoelectric Point: 5.6470
>T287612 WP_002393909.1 NZ_LR134312:c2476598-2476470 [Enterococcus faecalis]
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNDKK
MHFNERSIFLSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 129 bp
Antitoxin
Download Length: 180 bp
>AT287612 NZ_LR134312:2476346-2476525 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|