Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1012579..1012828 | Replicon | chromosome |
Accession | NZ_LR134304 | ||
Organism | Staphylococcus schweitzeri strain NCTC13712 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | EL116_RS05055 | Protein ID | WP_000623369.1 |
Coordinates | 1012579..1012686 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1012681..1012828 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
EL116_RS05030 | 1009254..1009823 | - | 570 | WP_047424746.1 | competence protein ComK | - |
EL116_RS05035 | 1010033..1010251 | + | 219 | WP_047531347.1 | IDEAL domain-containing protein | - |
EL116_RS05040 | 1010332..1011318 | - | 987 | WP_047531349.1 | lipoate--protein ligase | - |
EL116_RS05045 | 1011515..1011691 | + | 177 | WP_000214898.1 | YkvS family protein | - |
EL116_RS05050 | 1011706..1012308 | + | 603 | WP_047531351.1 | CPBP family intramembrane metalloprotease | - |
EL116_RS05055 | 1012579..1012686 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1012681..1012828 | - | 148 | - | - | Antitoxin |
EL116_RS05060 | 1013283..1013567 | + | 285 | WP_000790905.1 | lactococcin 972 family bacteriocin | - |
EL116_RS05065 | 1013611..1015575 | + | 1965 | WP_047550786.1 | bacteriocin-associated integral membrane family protein | - |
EL116_RS05070 | 1015578..1015898 | + | 321 | WP_000668623.1 | YxeA family protein | - |
EL116_RS05075 | 1015895..1016536 | + | 642 | WP_047550789.1 | ABC transporter ATP-binding protein | - |
EL116_RS05080 | 1016625..1016915 | - | 291 | WP_078101769.1 | hypothetical protein | - |
EL116_RS05085 | 1017209..1017496 | + | 288 | WP_047531360.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T287543 WP_000623369.1 NZ_LR134304:1012579-1012686 [Staphylococcus schweitzeri]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 148 bp
>AT287543 NZ_LR134304:c1012828-1012681 [Staphylococcus schweitzeri]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTATTGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTATTGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|