Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1016682..1016931 | Replicon | chromosome |
Accession | NZ_LR134093 | ||
Organism | Staphylococcus aureus strain NCTC11965 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | ELZ56_RS05035 | Protein ID | WP_000623369.1 |
Coordinates | 1016682..1016789 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 1016784..1016931 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ELZ56_RS05010 | 1013355..1013924 | - | 570 | WP_000287265.1 | competence protein ComK | - |
ELZ56_RS05015 | 1014134..1014352 | + | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
ELZ56_RS05020 | 1014433..1015419 | - | 987 | WP_000668820.1 | lipoate--protein ligase | - |
ELZ56_RS05025 | 1015618..1015794 | + | 177 | WP_000214898.1 | YkvS family protein | - |
ELZ56_RS05030 | 1015809..1016411 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
ELZ56_RS05035 | 1016682..1016789 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 1016784..1016931 | - | 148 | - | - | Antitoxin |
ELZ56_RS05040 | 1017328..1017429 | + | 102 | WP_001790623.1 | hypothetical protein | - |
ELZ56_RS05045 | 1017439..1017711 | + | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
ELZ56_RS05050 | 1017755..1019719 | + | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
ELZ56_RS05055 | 1019722..1020042 | + | 321 | WP_000873929.1 | YxeA family protein | - |
ELZ56_RS05060 | 1020039..1020680 | + | 642 | WP_000571191.1 | ABC transporter ATP-binding protein | - |
ELZ56_RS05065 | 1020768..1021058 | - | 291 | WP_001791476.1 | hypothetical protein | - |
ELZ56_RS05070 | 1021399..1021686 | + | 288 | WP_000410718.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T286782 WP_000623369.1 NZ_LR134093:1016682-1016789 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 148 bp
>AT286782 NZ_LR134093:c1016931-1016784 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|