Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 963230..963479 | Replicon | chromosome |
Accession | NZ_LN854556 | ||
Organism | Staphylococcus aureus strain B155 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SABB155_RS04705 | Protein ID | WP_000623369.1 |
Coordinates | 963230..963337 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF2 | ||
Locus tag | - | ||
Coordinates | 963332..963479 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SABB155_RS04680 | 959896..960465 | - | 570 | WP_000287265.1 | competence protein ComK | - |
SABB155_RS04685 | 960675..960893 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
SABB155_RS04690 | 960982..961968 | - | 987 | WP_054190346.1 | lipoate--protein ligase | - |
SABB155_RS04695 | 962167..962343 | + | 177 | WP_000214898.1 | YkvS family protein | - |
SABB155_RS04700 | 962358..962960 | + | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
SABB155_RS04705 | 963230..963337 | + | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
- | 963332..963479 | - | 148 | - | - | Antitoxin |
SABB155_RS04710 | 963975..964259 | + | 285 | WP_054190345.1 | lactococcin 972 family bacteriocin | - |
SABB155_RS04715 | 964303..966267 | + | 1965 | WP_054190344.1 | bacteriocin-associated integral membrane family protein | - |
SABB155_RS04720 | 966270..966590 | + | 321 | WP_054190343.1 | YxeA family protein | - |
SABB155_RS04725 | 966587..967228 | + | 642 | WP_054190342.1 | ABC transporter ATP-binding protein | - |
SABB155_RS14205 | 967316..967606 | - | 291 | WP_077446589.1 | hypothetical protein | - |
SABB155_RS14210 | 967747..967884 | + | 138 | WP_077446590.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 958057..959373 | 1316 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T285696 WP_000623369.1 NZ_LN854556:963230-963337 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 148 bp
>AT285696 NZ_LN854556:c963479-963332 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAATAATGTAAAAAGACGACATGCAGGAACATGTCGCCTATTGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTGGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAATAATGTAAAAAGACGACATGCAGGAACATGTCGCCTATTGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCGTTGTCAAAGTTTGGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|