Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1459317..1459514 | Replicon | chromosome |
Accession | NZ_LN626917 | ||
Organism | Staphylococcus aureus strain ILRI_Eymole1/1 isolate Staphylococcus aureus isolate ILRI_Eymole1/1 |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SRS_RS07240 | Protein ID | WP_000623369.1 |
Coordinates | 1459407..1459514 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF3 | ||
Locus tag | - | ||
Coordinates | 1459317..1459354 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SRS_RS07210 | 1454510..1454797 | - | 288 | WP_000410718.1 | hypothetical protein | - |
SRS_RS15100 | 1455138..1455428 | + | 291 | WP_001791476.1 | hypothetical protein | - |
SRS_RS07220 | 1455516..1456157 | - | 642 | WP_000571183.1 | ABC transporter ATP-binding protein | - |
SRS_RS07225 | 1456154..1456474 | - | 321 | WP_000873929.1 | YxeA family protein | - |
SRS_RS07230 | 1456477..1458441 | - | 1965 | WP_045179017.1 | bacteriocin-associated integral membrane family protein | - |
SRS_RS15105 | 1458485..1458757 | - | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
SRS_RS07235 | 1458767..1458868 | - | 102 | WP_001790623.1 | hypothetical protein | - |
- | 1459317..1459354 | + | 38 | - | - | Antitoxin |
SRS_RS07240 | 1459407..1459514 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
SRS_RS07245 | 1459785..1460387 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
SRS_RS07250 | 1460402..1460578 | - | 177 | WP_000214898.1 | YkvS family protein | - |
SRS_RS07255 | 1460777..1461763 | + | 987 | WP_000668820.1 | lipoate--protein ligase | - |
SRS_RS07260 | 1461844..1462062 | - | 219 | WP_045179020.1 | IDEAL domain-containing protein | - |
SRS_RS07265 | 1462272..1462841 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T285489 WP_000623369.1 NZ_LN626917:c1459514-1459407 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
Antitoxin
Download Length: 38 bp
>AT285489 NZ_LN626917:1459317-1459354 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|