Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | sprG-sprF/- |
Location | 1785818..1786048 | Replicon | chromosome |
Accession | NZ_LN554884 | ||
Organism | Staphylococcus xylosus strain C2a |
Toxin (Protein)
Gene name | SprG2 | Uniprot ID | - |
Locus tag | SXYL_RS13295 | Protein ID | WP_080892139.1 |
Coordinates | 1785941..1786048 (-) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprF1 | ||
Locus tag | - | ||
Coordinates | 1785818..1785949 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
SXYL_RS08460 | 1781164..1783047 | - | 1884 | WP_047172518.1 | glycosyltransferase | - |
SXYL_RS08465 | 1783569..1783817 | - | 249 | WP_029379025.1 | GlsB/YeaQ/YmgE family stress response membrane protein | - |
SXYL_RS13490 | 1784804..1784956 | - | 153 | WP_153227674.1 | hypothetical protein | - |
- | 1785818..1785949 | + | 132 | NuclAT_0 | - | Antitoxin |
- | 1785818..1785949 | + | 132 | NuclAT_0 | - | Antitoxin |
- | 1785818..1785949 | + | 132 | NuclAT_0 | - | Antitoxin |
- | 1785818..1785949 | + | 132 | NuclAT_0 | - | Antitoxin |
SXYL_RS13295 | 1785941..1786048 | - | 108 | WP_080892139.1 | putative holin-like toxin | Toxin |
SXYL_RS08475 | 1786854..1787045 | - | 192 | WP_047172519.1 | hypothetical protein | - |
SXYL_RS08480 | 1787391..1787801 | - | 411 | WP_047172520.1 | YolD-like family protein | - |
SXYL_RS08485 | 1787948..1788310 | - | 363 | WP_047173057.1 | protein-export chaperone SecB | - |
SXYL_RS08490 | 1788349..1788708 | - | 360 | WP_047172521.1 | hypothetical protein | - |
SXYL_RS08495 | 1788715..1789287 | - | 573 | WP_047172522.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1781164..1830154 | 48990 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3772.76 Da Isoelectric Point: 10.4997
>T285459 WP_080892139.1 NZ_LN554884:c1786048-1785941 [Staphylococcus xylosus]
VVSIVEALHLMLGFGTFIVILLGLVIAIVKLSHKK
VVSIVEALHLMLGFGTFIVILLGLVIAIVKLSHKK
Download Length: 108 bp
Antitoxin
Download Length: 132 bp
>AT285459 NZ_LN554884:1785818-1785949 [Staphylococcus xylosus]
ATAGATAGAAAAAGGGCAATACACCATAAGTGTATCGCCCCAGTGAGCCCGTTAAAAAGACGGTGGCTAGTTACTAATAA
TTATCAAAAAATAATCATCGAAACCGGCCAAAGTTAGCGATGGTTATTTTTT
ATAGATAGAAAAAGGGCAATACACCATAAGTGTATCGCCCCAGTGAGCCCGTTAAAAAGACGGTGGCTAGTTACTAATAA
TTATCAAAAAATAATCATCGAAACCGGCCAAAGTTAGCGATGGTTATTTTTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|