Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2607212..2607469 | Replicon | chromosome |
Accession | NZ_CP128464 | ||
Organism | Enterococcus faecalis strain RE25 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | QSV41_RS13290 | Protein ID | WP_021164441.1 |
Coordinates | 2607368..2607469 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2607212..2607419 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QSV41_RS13265 | 2602896..2603849 | - | 954 | WP_002370087.1 | siderophore ABC transporter substrate-binding protein | - |
QSV41_RS13270 | 2603888..2604643 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
QSV41_RS13275 | 2604640..2605605 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
QSV41_RS13280 | 2605602..2606549 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
QSV41_RS13285 | 2606734..2607186 | + | 453 | WP_002389410.1 | YueI family protein | - |
- | 2607212..2607419 | + | 208 | - | - | Antitoxin |
QSV41_RS13290 | 2607368..2607469 | - | 102 | WP_021164441.1 | putative holin-like toxin | Toxin |
QSV41_RS13295 | 2607801..2607902 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
QSV41_RS13300 | 2608092..2610362 | - | 2271 | WP_002389492.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
QSV41_RS13305 | 2610533..2611033 | + | 501 | WP_002372831.1 | cysteine hydrolase family protein | - |
QSV41_RS13310 | 2611432..2612328 | + | 897 | WP_002389477.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3598.36 Da Isoelectric Point: 6.0656
>T284588 WP_021164441.1 NZ_CP128464:c2607469-2607368 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNNKK
MSIEAALELMISFAAFVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 208 bp
>AT284588 NZ_CP128464:2607212-2607419 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATAAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTTATACCAAC
ACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTGAATCTTAACCGTTCGGCCTACGAAGCTTGTGAACGGTTAT
TTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|