Detailed information of TA system TA283260

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 92503..92928
• Replicon: plasmid pEND_Eco 16002
• Accession: NZ_CP126945
• Organism: Escherichia coli O1:K1:H7 strain APEC E16002

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: QQA28_RS25905
• Protein ID: WP_223195199.1
• Coordinates: 92806..92928 (+)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	92503..92714 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QQA28_RS25875 (88477)	88477..88974	+	498	WP_050427786.1	single-stranded DNA-binding protein	-
QQA28_RS25880 (89037)	89037..89270	+	234	WP_001209608.1	DUF905 domain-containing protein	-
QQA28_RS25885 (89329)	89329..91287	+	1959	Protein_80	ParB/RepB/Spo0J family partition protein	-
QQA28_RS25890 (91342)	91342..91776	+	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
QQA28_RS25895 (91773)	91773..92492	+	720	WP_001276275.1	plasmid SOS inhibition protein A	-
- (92503)	92503..92714	+	212	NuclAT_0	-	Antitoxin
- (92503)	92503..92714	+	212	NuclAT_0	-	Antitoxin
- (92503)	92503..92714	+	212	NuclAT_0	-	Antitoxin
- (92503)	92503..92714	+	212	NuclAT_0	-	Antitoxin
QQA28_RS25900 (92748)	92748..92861	+	114	Protein_83	DUF5431 family protein	-
QQA28_RS25905 (92806)	92806..92928	+	123	WP_223195199.1	Hok/Gef family protein	Toxin
QQA28_RS25910 (93229)	93229..93550	-	322	Protein_85	hypothetical protein	-
QQA28_RS25915 (93552)	93552..93838	+	287	Protein_86	hypothetical protein	-
QQA28_RS25920 (93957)	93957..94778	+	822	WP_001234485.1	DUF932 domain-containing protein	-
QQA28_RS25925 (95074)	95074..95676	-	603	WP_023145258.1	transglycosylase SLT domain-containing protein	-
QQA28_RS25930 (95998)	95998..96381	+	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
QQA28_RS25935 (96571)	96571..97257	+	687	WP_289251617.1	PAS domain-containing protein	-
QQA28_RS25940 (97351)	97351..97578	+	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	iroN / iroE / iroD / iroC / iroB / iucA / iucB / iucC / iucD / iutA / vat	1..191373	191373

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4536.35 Da
• Isoelectric Point: 8.2691

>T283260 WP_223195199.1 NZ_CP126945:92806-92928 [Escherichia coli O1:K1:H7]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT283260 NZ_CP126945:92503-92714 [Escherichia coli O1:K1:H7]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin