Detailed information of TA system TA283193

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 192500..192925
• Replicon: plasmid pEND_Eco 18055
• Accession: NZ_CP126941
• Organism: Escherichia coli O2:K1:H7 strain APEC E18055

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: QQA30_RS26360
• Protein ID: WP_223195199.1
• Coordinates: 192500..192622 (-)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	192714..192925 (-)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QQA30_RS26325 (187850)	187850..188077	-	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-
QQA30_RS26330 (188171)	188171..188857	-	687	WP_000332490.1	PAS domain-containing protein	-
QQA30_RS26335 (189047)	189047..189430	-	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
QQA30_RS26340 (189752)	189752..190354	+	603	WP_023145258.1	transglycosylase SLT domain-containing protein	-
QQA30_RS26345 (190650)	190650..191471	-	822	Protein_201	DUF932 domain-containing protein	-
QQA30_RS26350 (191590)	191590..191876	-	287	Protein_202	hypothetical protein	-
QQA30_RS26355 (191878)	191878..192199	+	322	Protein_203	hypothetical protein	-
QQA30_RS26360 (192500)	192500..192622	-	123	WP_223195199.1	Hok/Gef family protein	Toxin
QQA30_RS26365 (192567)	192567..192680	-	114	Protein_205	DUF5431 family protein	-
- (192714)	192714..192925	-	212	NuclAT_0	-	Antitoxin
- (192714)	192714..192925	-	212	NuclAT_0	-	Antitoxin
- (192714)	192714..192925	-	212	NuclAT_0	-	Antitoxin
- (192714)	192714..192925	-	212	NuclAT_0	-	Antitoxin
QQA30_RS26370 (192936)	192936..193655	-	720	WP_001276275.1	plasmid SOS inhibition protein A	-
QQA30_RS26375 (193652)	193652..194086	-	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
QQA30_RS26380 (194141)	194141..196099	-	1959	Protein_208	ParB/RepB/Spo0J family partition protein	-
QQA30_RS26385 (196158)	196158..196391	-	234	WP_001209608.1	DUF905 domain-containing protein	-
QQA30_RS26390 (196454)	196454..196951	-	498	WP_050427786.1	single-stranded DNA-binding protein	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	iutA / iucD / iucC / iucB / iucA / iroB / iroC / iroD / iroE / iroN / vat	1..199896	199896
	-	flank	IS/Tn	-	-	197797..198300	503

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4536.35 Da
• Isoelectric Point: 8.2691

>T283193 WP_223195199.1 NZ_CP126941:c192622-192500 [Escherichia coli O2:K1:H7]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT283193 NZ_CP126941:c192925-192714 [Escherichia coli O2:K1:H7]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin