Detailed information of TA system TA283069

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 16978..17403
• Replicon: plasmid pEND_Eco 12053-1
• Accession: NZ_CP126929
• Organism: Escherichia coli O2:K1:H4 strain APEC E12053

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: QQA27_RS24040
• Protein ID: WP_223195199.1
• Coordinates: 16978..17100 (-)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	17192..17403 (-)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QQA27_RS24005 (12328)	12328..12555	-	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-
QQA27_RS24010 (12649)	12649..13335	-	687	WP_000332490.1	PAS domain-containing protein	-
QQA27_RS24015 (13525)	13525..13908	-	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
QQA27_RS24020 (14230)	14230..14832	+	603	WP_023145258.1	transglycosylase SLT domain-containing protein	-
QQA27_RS24025 (15128)	15128..15949	-	822	WP_001234485.1	DUF932 domain-containing protein	-
QQA27_RS24030 (16068)	16068..16354	-	287	Protein_23	hypothetical protein	-
QQA27_RS24035 (16356)	16356..16677	+	322	Protein_24	hypothetical protein	-
QQA27_RS24040 (16978)	16978..17100	-	123	WP_223195199.1	Hok/Gef family protein	Toxin
QQA27_RS24045 (17045)	17045..17158	-	114	Protein_26	DUF5431 family protein	-
- (17192)	17192..17403	-	212	NuclAT_0	-	Antitoxin
- (17192)	17192..17403	-	212	NuclAT_0	-	Antitoxin
- (17192)	17192..17403	-	212	NuclAT_0	-	Antitoxin
- (17192)	17192..17403	-	212	NuclAT_0	-	Antitoxin
QQA27_RS24050 (17414)	17414..18133	-	720	WP_001276275.1	plasmid SOS inhibition protein A	-
QQA27_RS24055 (18130)	18130..18564	-	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
QQA27_RS24060 (18619)	18619..20577	-	1959	Protein_29	ParB/RepB/Spo0J family partition protein	-
QQA27_RS24065 (20636)	20636..20869	-	234	WP_001209608.1	DUF905 domain-containing protein	-
QQA27_RS24070 (20932)	20932..21429	-	498	WP_050427786.1	single-stranded DNA-binding protein	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	iutA / iucD / iucC / iucB / iucA / iroB / iroC / iroD / iroE / iroN / vat	1..189727	189727
	-	flank	IS/Tn	-	-	22275..22778	503

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4536.35 Da
• Isoelectric Point: 8.2691

>T283069 WP_223195199.1 NZ_CP126929:c17100-16978 [Escherichia coli O2:K1:H4]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT283069 NZ_CP126929:c17403-17192 [Escherichia coli O2:K1:H4]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin