Detailed information of TA system TA283040

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 182186..182611
• Replicon: plasmid pEND_Eco 19035-1
• Accession: NZ_CP126927
• Organism: Escherichia coli O2:K1:H5 strain APEC E19035

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: QQA32_RS27075
• Protein ID: WP_223195199.1
• Coordinates: 182186..182308 (-)
• Length: 41 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	182400..182611 (-)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QQA32_RS27040 (177536)	177536..177763	-	228	WP_001442099.1	conjugal transfer relaxosome protein TraY	-
QQA32_RS27045 (177857)	177857..178543	-	687	WP_000332490.1	PAS domain-containing protein	-
QQA32_RS27050 (178733)	178733..179116	-	384	WP_000124981.1	conjugal transfer relaxosome DNA-binding protein TraM	-
QQA32_RS27055 (179438)	179438..180040	+	603	WP_023145258.1	transglycosylase SLT domain-containing protein	-
QQA32_RS27060 (180336)	180336..181157	-	822	WP_001234485.1	DUF932 domain-containing protein	-
QQA32_RS27065 (181276)	181276..181562	-	287	Protein_189	hypothetical protein	-
QQA32_RS27070 (181564)	181564..181885	+	322	Protein_190	hypothetical protein	-
QQA32_RS27075 (182186)	182186..182308	-	123	WP_223195199.1	Hok/Gef family protein	Toxin
QQA32_RS27080 (182253)	182253..182366	-	114	Protein_192	DUF5431 family protein	-
- (182400)	182400..182611	-	212	NuclAT_0	-	Antitoxin
- (182400)	182400..182611	-	212	NuclAT_0	-	Antitoxin
- (182400)	182400..182611	-	212	NuclAT_0	-	Antitoxin
- (182400)	182400..182611	-	212	NuclAT_0	-	Antitoxin
QQA32_RS27085 (182622)	182622..183341	-	720	WP_001276275.1	plasmid SOS inhibition protein A	-
QQA32_RS27090 (183338)	183338..183772	-	435	WP_000845935.1	conjugation system SOS inhibitor PsiB	-
QQA32_RS27095 (183827)	183827..185785	-	1959	WP_103433225.1	ParB/RepB/Spo0J family partition protein	-
QQA32_RS27100 (185844)	185844..186077	-	234	WP_001209608.1	DUF905 domain-containing protein	-
QQA32_RS27105 (186140)	186140..186637	-	498	WP_050575774.1	single-stranded DNA-binding protein	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	sitABCD	iutA / iucD / iucC / iucB / iucA / iroB / iroC / iroD / iroE / iroN / vat	1..193604	193604
	-	flank	IS/Tn	-	-	187483..187986	503

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (1-35)

Sequences

Toxin

Protein

• Length: 41 a.a.
• Molecular weight: 4536.35 Da
• Isoelectric Point: 8.2691

>T283040 WP_223195199.1 NZ_CP126927:c182308-182186 [Escherichia coli O2:K1:H5]
IVCCTLLIFTLLTRNRLCEVRLKDGYREVTASLAYESSGK

Nucleotide

• Length: 123 bp

Antitoxin

Nucleotide

• Length: 212 bp

>AT283040 NZ_CP126927:c182611-182400 [Escherichia coli O2:K1:H5]
TCACACGGATTTCCCGTGAACGGTCTGAATGAGCGGATTCTTTTCAGGAAAAGTGAGTGTGGTCAGCGTGCAGGGATATG
AGCTATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGC
AGAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGCCCCCTGTATGTCT

Structures

Antitoxin