Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 1481293..1481548 | Replicon | chromosome |
| Accession | NZ_CP126631 | ||
| Organism | Staphylococcus aureus strain 33-40 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | QPR37_RS07340 | Protein ID | WP_063651022.1 |
| Coordinates | 1481293..1481400 (+) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF1 | ||
| Locus tag | - | ||
| Coordinates | 1481411..1481548 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QPR37_RS07320 (QPR37_07320) | 1476443..1480228 | + | 3786 | WP_285146592.1 | phage tail spike protein | - |
| QPR37_RS07325 (QPR37_07325) | 1480218..1480370 | + | 153 | WP_063651023.1 | hypothetical protein | - |
| QPR37_RS07330 (QPR37_07330) | 1480417..1480704 | + | 288 | WP_001040260.1 | hypothetical protein | - |
| QPR37_RS07335 (QPR37_07335) | 1480762..1481058 | + | 297 | WP_000539688.1 | DUF2951 domain-containing protein | - |
| QPR37_RS07340 (QPR37_07340) | 1481293..1481400 | + | 108 | WP_063651022.1 | putative holin-like toxin | Toxin |
| - | 1481411..1481548 | - | 138 | - | - | Antitoxin |
| QPR37_RS07350 (QPR37_07350) | 1481598..1481852 | + | 255 | WP_141060376.1 | phage holin | - |
| QPR37_RS07355 (QPR37_07355) | 1481864..1482619 | + | 756 | WP_259378798.1 | CHAP domain-containing protein | - |
| QPR37_RS07360 (QPR37_07360) | 1482967..1483893 | + | 927 | WP_000476436.1 | bi-component leukocidin LukMF' subunit M | - |
| QPR37_RS07365 (QPR37_07365) | 1483895..1484863 | + | 969 | WP_259378800.1 | bi-component leukocidin LukMF' subunit F' | - |
| QPR37_RS07370 (QPR37_07370) | 1485404..1485835 | + | 432 | WP_285146596.1 | Abi family protein | - |
| QPR37_RS07375 (QPR37_07375) | 1485922..1486341 | + | 420 | WP_285146992.1 | Abi family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | lukS-PV / lukD | 1443147..1487723 | 44576 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3828.80 Da Isoelectric Point: 10.4997
>T282998 WP_063651022.1 NZ_CP126631:1481293-1481400 [Staphylococcus aureus]
VVSVVDALNLMFSFGMFIVVLLGLVIAIVKLNHKK
VVSVVDALNLMFSFGMFIVVLLGLVIAIVKLNHKK
Download Length: 108 bp
Antitoxin
Download Length: 138 bp
>AT282998 NZ_CP126631:c1481548-1481411 [Staphylococcus aureus]
ATTTGATATTTATATTATGGTGTGTTAATTTATATATAGAAAAAGGCAACATGCGCAAACATGTTACCCTAATGAGCCCG
TTAAAAAGACGGTGGCTCAGTTTTGAAATTATTATAAAATAACCATTAACCGTCCAAA
ATTTGATATTTATATTATGGTGTGTTAATTTATATATAGAAAAAGGCAACATGCGCAAACATGTTACCCTAATGAGCCCG
TTAAAAAGACGGTGGCTCAGTTTTGAAATTATTATAAAATAACCATTAACCGTCCAAA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|