Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | SprA2-SprA2AS/- |
Location | 945740..945924 | Replicon | chromosome |
Accession | NZ_CP126631 | ||
Organism | Staphylococcus aureus strain 33-40 |
Toxin (Protein)
Gene name | SprA2 | Uniprot ID | - |
Locus tag | QPR37_RS04425 | Protein ID | WP_063650394.1 |
Coordinates | 945740..945847 (+) | Length | 36 a.a. |
Antitoxin (RNA)
Gene name | SprA2AS | ||
Locus tag | - | ||
Coordinates | 945864..945924 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QPR37_RS04400 (QPR37_04400) | 941102..941575 | + | 474 | WP_285146305.1 | GyrI-like domain-containing protein | - |
QPR37_RS04405 (QPR37_04405) | 941698..942909 | - | 1212 | WP_063650391.1 | multidrug effflux MFS transporter | - |
QPR37_RS04410 (QPR37_04410) | 943091..943750 | - | 660 | WP_031927729.1 | membrane protein | - |
QPR37_RS04415 (QPR37_04415) | 943810..944952 | - | 1143 | WP_063650393.1 | glycerate kinase | - |
QPR37_RS04420 (QPR37_04420) | 945220..945606 | + | 387 | WP_000779353.1 | flippase GtxA | - |
QPR37_RS04425 (QPR37_04425) | 945740..945847 | + | 108 | WP_063650394.1 | type I toxin-antitoxin system Fst family toxin | Toxin |
- | 945864..945924 | - | 61 | - | - | Antitoxin |
QPR37_RS04430 (QPR37_04430) | 946551..948314 | + | 1764 | WP_109162095.1 | ABC transporter ATP-binding protein | - |
QPR37_RS04435 (QPR37_04435) | 948339..950073 | + | 1735 | Protein_863 | ABC transporter ATP-binding protein | - |
QPR37_RS04440 (QPR37_04440) | 950304..950471 | + | 168 | WP_001798790.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3982.74 Da Isoelectric Point: 11.0391
>T282990 WP_063650394.1 NZ_CP126631:945740-945847 [Staphylococcus aureus]
MFNLLIDIMTSALSGCLVAFFAHRLRTRNNKKGDK
MFNLLIDIMTSALSGCLVAFFAHRLRTRNNKKGDK
Download Length: 108 bp
Antitoxin
Download Length: 61 bp
>AT282990 NZ_CP126631:c945924-945864 [Staphylococcus aureus]
TACATAATAAATTGAACATCTAAATACACCAAATCCCCTCACTACTGCCATAGTGAGGGGA
TACATAATAAATTGAACATCTAAATACACCAAATCCCCTCACTACTGCCATAGTGAGGGGA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|