Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | SprA2-SprA2AS/- |
| Location | 2226660..2226844 | Replicon | chromosome |
| Accession | NZ_CP126629 | ||
| Organism | Staphylococcus aureus strain 35-42 | ||
Toxin (Protein)
| Gene name | SprA2 | Uniprot ID | - |
| Locus tag | QPL68_RS10680 | Protein ID | WP_063650394.1 |
| Coordinates | 2226660..2226767 (+) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprA2AS | ||
| Locus tag | - | ||
| Coordinates | 2226784..2226844 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QPL68_RS10655 (QPL68_10655) | 2222022..2222495 | + | 474 | WP_285146305.1 | GyrI-like domain-containing protein | - |
| QPL68_RS10660 (QPL68_10660) | 2222618..2223829 | - | 1212 | WP_063650391.1 | multidrug effflux MFS transporter | - |
| QPL68_RS10665 (QPL68_10665) | 2224011..2224670 | - | 660 | WP_031927729.1 | membrane protein | - |
| QPL68_RS10670 (QPL68_10670) | 2224730..2225872 | - | 1143 | WP_063650393.1 | glycerate kinase | - |
| QPL68_RS10675 (QPL68_10675) | 2226140..2226526 | + | 387 | WP_000779353.1 | flippase GtxA | - |
| QPL68_RS10680 (QPL68_10680) | 2226660..2226767 | + | 108 | WP_063650394.1 | type I toxin-antitoxin system Fst family toxin | Toxin |
| - | 2226784..2226844 | - | 61 | - | - | Antitoxin |
| QPL68_RS10685 (QPL68_10685) | 2227471..2229234 | + | 1764 | WP_109162095.1 | ABC transporter ATP-binding protein | - |
| QPL68_RS10690 (QPL68_10690) | 2229259..2230993 | + | 1735 | Protein_2071 | ABC transporter ATP-binding protein | - |
| QPL68_RS10695 (QPL68_10695) | 2231224..2231391 | + | 168 | WP_001798790.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3982.74 Da Isoelectric Point: 11.0391
>T282982 WP_063650394.1 NZ_CP126629:2226660-2226767 [Staphylococcus aureus]
MFNLLIDIMTSALSGCLVAFFAHRLRTRNNKKGDK
MFNLLIDIMTSALSGCLVAFFAHRLRTRNNKKGDK
Download Length: 108 bp
Antitoxin
Download Length: 61 bp
>AT282982 NZ_CP126629:c2226844-2226784 [Staphylococcus aureus]
TACATAATAAATTGAACATCTAAATACACCAAATCCCCTCACTACTGCCATAGTGAGGGGA
TACATAATAAATTGAACATCTAAATACACCAAATCCCCTCACTACTGCCATAGTGAGGGGA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|