Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 19417..19633 | Replicon | chromosome |
| Accession | NZ_CP126629 | ||
| Organism | Staphylococcus aureus strain 35-42 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | QPL68_RS00105 | Protein ID | WP_063651022.1 |
| Coordinates | 19417..19524 (+) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF3 | ||
| Locus tag | - | ||
| Coordinates | 19579..19633 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QPL68_RS00085 (QPL68_00085) | 14567..18352 | + | 3786 | WP_285146592.1 | phage tail spike protein | - |
| QPL68_RS00090 (QPL68_00090) | 18342..18494 | + | 153 | WP_063651023.1 | hypothetical protein | - |
| QPL68_RS00095 (QPL68_00095) | 18541..18828 | + | 288 | WP_001040260.1 | hypothetical protein | - |
| QPL68_RS00100 (QPL68_00100) | 18886..19182 | + | 297 | WP_000539688.1 | DUF2951 domain-containing protein | - |
| QPL68_RS00105 (QPL68_00105) | 19417..19524 | + | 108 | WP_063651022.1 | putative holin-like toxin | Toxin |
| QPL68_RS00110 (QPL68_00110) | 19567..19670 | - | 104 | Protein_21 | hypothetical protein | - |
| - | 19579..19633 | - | 55 | - | - | Antitoxin |
| QPL68_RS00115 (QPL68_00115) | 19722..19976 | + | 255 | WP_141060376.1 | phage holin | - |
| QPL68_RS00120 (QPL68_00120) | 19988..20743 | + | 756 | WP_259378798.1 | CHAP domain-containing protein | - |
| QPL68_RS00125 (QPL68_00125) | 21091..22017 | + | 927 | WP_000476436.1 | bi-component leukocidin LukMF' subunit M | - |
| QPL68_RS00130 (QPL68_00130) | 22019..22987 | + | 969 | WP_259378800.1 | bi-component leukocidin LukMF' subunit F' | - |
| QPL68_RS00135 (QPL68_00135) | 23528..23959 | + | 432 | WP_285146596.1 | Abi family protein | - |
| QPL68_RS00140 (QPL68_00140) | 24046..24465 | + | 420 | WP_285146992.1 | Abi family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | lukS-PV / lukD | 1..25847 | 25846 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3828.80 Da Isoelectric Point: 10.4997
>T282978 WP_063651022.1 NZ_CP126629:19417-19524 [Staphylococcus aureus]
VVSVVDALNLMFSFGMFIVVLLGLVIAIVKLNHKK
VVSVVDALNLMFSFGMFIVVLLGLVIAIVKLNHKK
Download Length: 108 bp
Antitoxin
Download Length: 55 bp
>AT282978 NZ_CP126629:c19633-19579 [Staphylococcus aureus]
AAAAAGGCAACATGCGCAAACATGTTACCCTAATGAGCCCGTTAAAAAGACGGTG
AAAAAGGCAACATGCGCAAACATGTTACCCTAATGAGCCCGTTAAAAAGACGGTG
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|