Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2683871..2684131 | Replicon | chromosome |
| Accession | NZ_CP124923 | ||
| Organism | Enterococcus faecalis strain EfsC11 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ48_RS13140 | Protein ID | WP_075551663.1 |
| Coordinates | 2684030..2684131 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2683871..2684081 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ48_RS13115 (2679555) | 2679555..2680508 | - | 954 | WP_002359060.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ48_RS13120 (2680547) | 2680547..2681302 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ48_RS13125 (2681299) | 2681299..2682264 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ48_RS13130 (2682261) | 2682261..2683208 | - | 948 | WP_002404023.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ48_RS13135 (2683393) | 2683393..2683845 | + | 453 | WP_002354958.1 | YueI family protein | - |
| - (2683871) | 2683871..2684081 | + | 211 | NuclAT_4 | - | Antitoxin |
| - (2683908) | 2683908..2684085 | + | 178 | NuclAT_3 | - | - |
| QLQ48_RS13140 (2684030) | 2684030..2684131 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
| - (2684305) | 2684305..2684514 | + | 210 | NuclAT_5 | - | - |
| - (2684339) | 2684339..2684518 | + | 180 | NuclAT_2 | - | - |
| QLQ48_RS13145 (2684463) | 2684463..2684564 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
| QLQ48_RS13150 (2684754) | 2684754..2687024 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ48_RS13155 (2687195) | 2687195..2687695 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281830 WP_075551663.1 NZ_CP124923:c2684131-2684030 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT281830 NZ_CP124923:2683871-2684081 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|