Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 457656..457910 | Replicon | chromosome |
Accession | NZ_CP124914 | ||
Organism | Enterococcus faecalis strain EfsC8 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | QLQ37_RS02265 | Protein ID | WP_002355568.1 |
Coordinates | 457656..457772 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 457755..457910 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ37_RS02255 (453094) | 453094..455352 | + | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
QLQ37_RS02260 (455478) | 455478..457508 | + | 2031 | WP_002375948.1 | NAD-dependent DNA ligase LigA | - |
QLQ37_RS02265 (457656) | 457656..457772 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
- (457683) | 457683..457888 | - | 206 | NuclAT_3 | - | - |
- (457755) | 457755..457890 | - | 136 | NuclAT_9 | - | - |
- (457755) | 457755..457910 | - | 156 | NuclAT_7 | - | Antitoxin |
QLQ37_RS02270 (458090) | 458090..458395 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
QLQ37_RS02275 (458395) | 458395..459864 | + | 1470 | WP_002419989.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
QLQ37_RS02280 (459864) | 459864..461294 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
QLQ37_RS02285 (461313) | 461313..462401 | + | 1089 | WP_002383001.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T281739 WP_002355568.1 NZ_CP124914:457656-457772 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 156 bp
>AT281739 NZ_CP124914:c457910-457755 [Enterococcus faecalis]
GAAATATGTTATTATGAAAATGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTG
GTGGCTTACTGAGTTATTGGTTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
GAAATATGTTATTATGAAAATGAAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACCAGTTATAAGAACTG
GTGGCTTACTGAGTTATTGGTTTTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTT
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|