Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2464938..2465170 | Replicon | chromosome |
Accession | NZ_CP124913 | ||
Organism | Enterococcus faecalis strain EfsC20 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | QLQ32_RS11810 | Protein ID | WP_002355568.1 |
Coordinates | 2465054..2465170 (-) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2464938..2465143 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ32_RS11790 | 2460425..2461513 | - | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
QLQ32_RS11795 | 2461532..2462962 | - | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
QLQ32_RS11800 | 2462962..2464431 | - | 1470 | WP_002358701.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
QLQ32_RS11805 | 2464431..2464736 | - | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
- | 2464938..2465143 | + | 206 | - | - | Antitoxin |
QLQ32_RS11810 | 2465054..2465170 | - | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
QLQ32_RS11815 | 2465318..2467348 | - | 2031 | WP_002384934.1 | NAD-dependent DNA ligase LigA | - |
QLQ32_RS11820 | 2467474..2469732 | - | 2259 | WP_002363179.1 | DNA helicase PcrA | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | - | psaA / esp / cylI / cylA / cylB / cylM / cylS / cylL / cylR1 / cylR2 | 2463019..2660643 | 197624 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T281732 WP_002355568.1 NZ_CP124913:c2465170-2465054 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT281732 NZ_CP124913:2464938-2465143 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTTTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTTTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|