Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2732400..2732659 | Replicon | chromosome |
Accession | NZ_CP124911 | ||
Organism | Enterococcus faecalis strain EfsC61 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | QLQ53_RS13520 | Protein ID | WP_075551663.1 |
Coordinates | 2732558..2732659 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2732400..2732609 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ53_RS13490 | 2727650..2728603 | - | 954 | WP_010785614.1 | siderophore ABC transporter substrate-binding protein | - |
QLQ53_RS13495 | 2728642..2729397 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
QLQ53_RS13500 | 2729394..2730359 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ53_RS13505 | 2730356..2731303 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ53_RS13510 | 2731488..2731940 | + | 453 | WP_002354958.1 | YueI family protein | - |
QLQ53_RS13515 | 2732125..2732226 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
- | 2732400..2732609 | + | 210 | - | - | Antitoxin |
QLQ53_RS13520 | 2732558..2732659 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
QLQ53_RS13525 | 2732991..2733092 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
QLQ53_RS13530 | 2733282..2735552 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
QLQ53_RS13535 | 2735786..2736223 | + | 438 | WP_010785615.1 | cysteine hydrolase family protein | - |
QLQ53_RS13540 | 2736622..2737518 | + | 897 | WP_002365354.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281710 WP_075551663.1 NZ_CP124911:c2732659-2732558 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 210 bp
>AT281710 NZ_CP124911:2732400-2732609 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|