Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2619552..2619812 | Replicon | chromosome |
Accession | NZ_CP124908 | ||
Organism | Enterococcus faecalis strain EfsC33 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | QLQ33_RS12745 | Protein ID | WP_075551663.1 |
Coordinates | 2619711..2619812 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2619552..2619762 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ33_RS12720 (2615236) | 2615236..2616189 | - | 954 | WP_002394760.1 | siderophore ABC transporter substrate-binding protein | - |
QLQ33_RS12725 (2616228) | 2616228..2616983 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
QLQ33_RS12730 (2616980) | 2616980..2617945 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ33_RS12735 (2617942) | 2617942..2618889 | - | 948 | WP_002359058.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ33_RS12740 (2619074) | 2619074..2619526 | + | 453 | WP_002359057.1 | YueI family protein | - |
- (2619552) | 2619552..2619762 | + | 211 | NuclAT_4 | - | Antitoxin |
- (2619589) | 2619589..2619766 | + | 178 | NuclAT_12 | - | - |
QLQ33_RS12745 (2619711) | 2619711..2619812 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
QLQ33_RS12750 (2620001) | 2620001..2622271 | - | 2271 | WP_002354955.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
QLQ33_RS12755 (2622442) | 2622442..2622942 | + | 501 | WP_010709949.1 | cysteine hydrolase family protein | - |
QLQ33_RS12760 (2623245) | 2623245..2624141 | + | 897 | WP_002354953.1 | YitT family protein | - |
QLQ33_RS12765 (2624192) | 2624192..2624590 | - | 399 | WP_002354951.1 | glyoxalase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281675 WP_075551663.1 NZ_CP124908:c2619812-2619711 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 211 bp
>AT281675 NZ_CP124908:2619552-2619762 [Enterococcus faecalis]
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
TTCCATTTATAATAGAATTATGCTATTATGAAAATGAAAAAGAGAGGTATGCGGGTACATACCTCTCTTTTATACCAACA
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGT
TATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTAGTGCA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|