Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2487997..2488222 | Replicon | chromosome |
Accession | NZ_CP124906 | ||
Organism | Enterococcus faecalis strain EfsC49 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | QLQ59_RS12005 | Protein ID | WP_075551663.1 |
Coordinates | 2488121..2488222 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2487997..2488176 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ59_RS11975 | 2483213..2484166 | - | 954 | WP_002354964.1 | siderophore ABC transporter substrate-binding protein | - |
QLQ59_RS11980 | 2484205..2484960 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
QLQ59_RS11985 | 2484957..2485922 | - | 966 | WP_002354961.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ59_RS11990 | 2485919..2486866 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
QLQ59_RS11995 | 2487051..2487503 | + | 453 | WP_002354958.1 | YueI family protein | - |
QLQ59_RS12000 | 2487688..2487789 | - | 102 | WP_075551663.1 | putative holin-like toxin | - |
- | 2487997..2488176 | + | 180 | - | - | Antitoxin |
QLQ59_RS12005 | 2488121..2488222 | - | 102 | WP_075551663.1 | putative holin-like toxin | Toxin |
QLQ59_RS12010 | 2488412..2490682 | - | 2271 | WP_002392683.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
QLQ59_RS12015 | 2490853..2491353 | + | 501 | WP_002354954.1 | cysteine hydrolase family protein | - |
QLQ59_RS12020 | 2491900..2492796 | + | 897 | WP_010784075.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3599.34 Da Isoelectric Point: 4.5869
>T281657 WP_075551663.1 NZ_CP124906:c2488222-2488121 [Enterococcus faecalis]
MSIEAALELMISFAAFVALLIFGILEATKNDKK
MSIEAALELMISFAAFVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 180 bp
>AT281657 NZ_CP124906:2487997-2488176 [Enterococcus faecalis]
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
TGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACACCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGT
TTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTTATTTTTTATCGTTTTTCGTTGCTTCAAGGATACC
GAAAATCAGTAGTGCAACAA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|