Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 497381..497613 | Replicon | chromosome |
Accession | NZ_CP124906 | ||
Organism | Enterococcus faecalis strain EfsC49 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | C7CXQ5 |
Locus tag | QLQ59_RS02460 | Protein ID | WP_002355568.1 |
Coordinates | 497381..497497 (+) | Length | 39 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 497408..497613 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
QLQ59_RS02450 | 492819..495077 | + | 2259 | WP_002364805.1 | DNA helicase PcrA | - |
QLQ59_RS02455 | 495203..497233 | + | 2031 | WP_002381252.1 | NAD-dependent DNA ligase LigA | - |
QLQ59_RS02460 | 497381..497497 | + | 117 | WP_002355568.1 | putative holin-like toxin | Toxin |
- | 497408..497613 | - | 206 | - | - | Antitoxin |
QLQ59_RS02465 | 497815..498120 | + | 306 | WP_002355569.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC | - |
QLQ59_RS02470 | 498120..499589 | + | 1470 | WP_002358701.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA | - |
QLQ59_RS02475 | 499589..501019 | + | 1431 | WP_002358703.1 | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB | - |
QLQ59_RS02480 | 501038..502126 | + | 1089 | WP_002355572.1 | diacylglycerol kinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 39 a.a. Molecular weight: 4065.93 Da Isoelectric Point: 5.9482
>T281649 WP_002355568.1 NZ_CP124906:497381-497497 [Enterococcus faecalis]
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
MFLSVEAALGLMIGFATLVVTIIFGILALVLDNKNNRS
Download Length: 117 bp
Antitoxin
Download Length: 206 bp
>AT281649 NZ_CP124906:c497613-497408 [Enterococcus faecalis]
AAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
AAAAGAGAGATATGCAGGAACATACCTCTCTAATAGCCACTACTAGTTATAAGAACTAGCGGCTTACTGAGTTATTGGTT
TTATTTCAAACGCTTAACCGTTCAGCTCCTCAAAGCTTATGAACGGTTATTTTTGTTGTCTAAGACAAGCGCTAAGATAC
CGAAGATAATGGTCACAACAAGTGTTGCAAAACCAATCATCAGTCC
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|