Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2598079..2598338 | Replicon | chromosome |
| Accession | NZ_CP124901 | ||
| Organism | Enterococcus faecalis strain EfsC94 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | QLQ35_RS12680 | Protein ID | WP_021164442.1 |
| Coordinates | 2598237..2598338 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2598079..2598283 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| QLQ35_RS12650 (2593331) | 2593331..2594284 | - | 954 | WP_010830689.1 | siderophore ABC transporter substrate-binding protein | - |
| QLQ35_RS12655 (2594323) | 2594323..2595078 | - | 756 | WP_002354962.1 | ATP-binding cassette domain-containing protein | - |
| QLQ35_RS12660 (2595075) | 2595075..2596040 | - | 966 | WP_002367415.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ35_RS12665 (2596037) | 2596037..2596984 | - | 948 | WP_002354960.1 | iron chelate uptake ABC transporter family permease subunit | - |
| QLQ35_RS12670 (2597169) | 2597169..2597621 | + | 453 | WP_002378959.1 | YueI family protein | - |
| - (2597647) | 2597647..2597854 | + | 208 | NuclAT_1 | - | - |
| - (2597684) | 2597684..2597858 | + | 175 | NuclAT_5 | - | - |
| QLQ35_RS12675 (2597803) | 2597803..2597904 | - | 102 | WP_021164441.1 | putative holin-like toxin | - |
| - (2598079) | 2598079..2598283 | + | 205 | NuclAT_2 | - | Antitoxin |
| - (2598113) | 2598113..2598300 | + | 188 | NuclAT_4 | - | - |
| QLQ35_RS12680 (2598237) | 2598237..2598338 | - | 102 | WP_021164442.1 | putative holin-like toxin | Toxin |
| QLQ35_RS12685 (2598529) | 2598529..2600799 | - | 2271 | WP_282860979.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| QLQ35_RS12690 (2600970) | 2600970..2601471 | + | 502 | Protein_2473 | cysteine hydrolase family protein | - |
| QLQ35_RS12695 (2602163) | 2602163..2603059 | + | 897 | WP_002354953.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3625.38 Da Isoelectric Point: 4.5869
>T281620 WP_021164442.1 NZ_CP124901:c2598338-2598237 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNDKK
MSIEATLELMISFATLVALLIFGILEATKNDKK
Download Length: 102 bp
Antitoxin
Download Length: 205 bp
>AT281620 NZ_CP124901:2598079-2598283 [Enterococcus faecalis]
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTTAAATAGAATTATGCTATTATGAAAATGAAAAGAGAGATATGCTACTACATACCTCTCCTTTATACCAACAC
CAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTGTTGTTCTTTAACCGTTCAGCCGTCTAAGCTTATGAACGGTT
ATTTTTTATCGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|